SAXSdb — 1msw

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

Enterobacteria phage T7

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Monomer	Protein 1 DNA 2 RNA 1	Template DNA × 1 Non-Template DNA × 1 RNA message × 1 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOL_BPT7
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain D； PDBConstruct 1–883； UniProt 1–883

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1msw
Deposition date deposition_date	2002-09-19
Structure title title	Structural basis for the transition from initiation to elongation transcription in T7 RNA polymerase
Keywords keywords	T7RNAP elongation complex, TRANSCRIPTION-DNA-RNA COMPLEX; TRANSCRIPTION/DNA/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1msw__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1msw__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1msw__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	31.30 Å
Rg (electron density)	30.89 Å
Total Rg	31.49 Å
Atom count	7766
Residues	910
Excluded volume	135320 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1msw__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Template DNA
Molecular weight formula_weight	6117.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T
Atom count atom_count	7956

GCCGTGCGCATTCGCCGTGT

Entity 2 Entity 2 polymer

Description description	Non-Template DNA
Molecular weight formula_weight	5194.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	N

TTTACGTTGCGCACGGC

Entity 3 Entity 3 polymer

Description description	RNA message
Molecular weight formula_weight	3239.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R

GACACGGCGA

Entity 4 Entity 4 polymer

Description description	DNA-directed RNA polymerase
Molecular weight formula_weight	98984.2 kDa
EC 编号 ec_number	2.7.7.6
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D

MNTINIAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISPMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA

Source Source

Source organism organism	Enterobacteria phage T7
NCBI taxonomy ID ncbi_taxonomy_id	10760
Host organism host_organism	Escherichia coli BL21

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	190

▼

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

Domain ID domain_id	d1mswd_
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.8 — DNA/RNA polymerases
Superfamily Superfamily superfamily	e.8.1 — DNA/RNA polymerases
Family Family family	e.8.1.3 — T7 RNA polymerase

CATH v4.4 (5 domains)

Domain ID domain_id	1mswD01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1320 — T7 RNA polymerase; domain 1
Homologous superfamily homologous superfamily	10 — DNA-directed RNA polymerase, N-terminal domain

Domain ID domain_id	1mswD02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	260 —

Domain ID domain_id	1mswD03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	370 —

Domain ID domain_id	1mswD04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	280 —

Domain ID domain_id	1mswD05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

▶

Unit-cell length a length_a	142.910 Å
Unit-cell length b length_b	145.460 Å
Unit-cell length c length_c	145.600 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.100 Å
Low-resolution limit resolution_low	20.000 Å
R factor r_factor	0.2410
R_work r_work	0.2410
R_free r_free	0.2750

Structural basis for the transition from initiation to elongation transcription in T7 RNA polymerase

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1msw__assembly_1__model_1

1msw__assembly_1__model_1 | I(q)

1msw__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

CATH v4.4 (5 domains)

7. Citations (1)

Structural basis for the transition from initiation to elongation transcription in T7 RNA polymerase

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1msw__assembly_1__model_1

1msw__assembly_1__model_1 | I(q)

1msw__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

CATH v4.4 (5 domains)

7. Citations (1)