SAXSdb — 9dxh

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Resolvase homolog YokA

Bacillus subtilis

UniProt O32006

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 4 DNA 8 PDB declaration: 12-meric（12） Consistent with all polymer counts	Chain A； UniProt 1–545 Chain C； UniProt 1–545 Chain I； UniProt 1–545 Chain K； UniProt 1–545	Not recorded	DNA (34-MER) × 2 DNA (33-MER) × 2 DNA (25-MER) × 2 DNA (24-MER) × 2 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer：pH 8 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 4.69 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9DXH	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
9DXD attLmm bound serine integrase and RDF complex in the pre-rotation state Deposited 2024-10-11	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 8 PDB declaration: 16-meric	Chain A 1–545（545 aa） Chain B 1–545（545 aa） Chain C 1–545（545 aa） Chain D 1–545（545 aa） Chain I 1–545（545 aa） Chain J 1–545（545 aa） Chain K 1–545（545 aa） Chain L 1–545（545 aa）	Not recorded	ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.16 Å
9DXF attLmm bound serine integrase and RDF complex in the post-rotation state Deposited 2024-10-11	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 8 PDB declaration: 16-meric	Chain A 1–545（545 aa） Chain B 1–545（545 aa） Chain C 1–545（545 aa） Chain D 1–545（545 aa） Chain I 1–545（545 aa） Chain J 1–545（545 aa） Chain K 1–545（545 aa） Chain L 1–545（545 aa）	Not recorded	ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.16 Å
9DXG attP bound large serine integrase and RDF complex in the dimeric state (cleaved) Deposited 2024-10-11	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 4 PDB declaration: octameric	Chain A 1–545（545 aa） Chain B 1–545（545 aa） Chain C 1–545（545 aa） Chain D 1–545（545 aa）	Not recorded	ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 6.61 Å
9DXJ attPmm and attBmm bound serine integrase complex in the post-rotation state Deposited 2024-10-11	Parsed fields agree	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: 12-meric	Chain A 1–545（545 aa） Chain C 1–545（545 aa） Chain I 1–545（545 aa） Chain K 1–545（545 aa）	Not recorded	ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.69 Å
9DXK attPmm bound serine integrase complex in the tetrameric state Deposited 2024-10-11	Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: 12-meric	Chain A 1–545（545 aa） Chain C 1–545（545 aa） Chain I 1–545（545 aa） Chain K 1–545（545 aa）	Not recorded	ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.81 Å
9Y6V attPsym bound large serine integrase and RDF complex in the dimeric state Deposited 2025-09-09	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–545（545 aa） Chain B 1–545（545 aa） Chain C 1–545（545 aa） Chain D 1–545（545 aa）	Not recorded	ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 8；20mM Tris-HCl, 100mM NaCl cryo-EM vitrification conditions Cryogen ETHANE	Resolution 7.10 Å

6 other PDB entries and 6 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	YOKA_BACSU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–545； UniProt 1–545 Author chain C； PDBConstruct 1–545； UniProt 1–545 Author chain I； PDBConstruct 1–545； UniProt 1–545 Author chain K； PDBConstruct 1–545； UniProt 1–545

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9dxh
Deposition date deposition_date	2024-10-11
Structure title title	attPmm and attBmm bound serine integrase complex in the pre-rotation state
Keywords keywords	Viral protein, Integrase, Recombinase, Complex, Recombination Directionality Factor, Integration, Excision, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	56.95 Å
Radius of gyration Rg (electron density) rg_electron	55.21 Å
Forward intensity I(0) i0	1938610000.00
Molecular weight molecular_weight	320120.0 kDa
Excluded volume excluded_volume	381380 Å³
Envelope volume envelope_volume	605450 Å³
Hydration-shell volume shell_volume	95401 Å³
Envelope diameter envelope_diameter	233.1 Å
Shell Rg shell_rg	53.81 Å
Envelope Rg envelope_rg	55.08 Å
Shape Rg shape_rg	55.12 Å
Total Rg total_rg	55.45 Å
Total atoms total_atoms	42532
Residues n_residues	2372
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	215.6 Å
Rg (real space) rg_real	57.15 Å
Rg uncertainty (real space) rg_real_error	2.52 Å
I(0) (real space) i0_real	1.9390e+09
I(0) uncertainty (real space) i0_real_error	4.3610e+07
Rg (reciprocal space) rg_reciprocal	56.78 Å
I(0) (reciprocal space) i0_reciprocal	1938000000.0000
Solution quality estimate total_estimate	0.8360
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	69.3 Å
Skewness Skewness skewness	0.485
Kurtosis Kurtosis kurtosis	0.086
Angular range angular_range	— – 0.1400 Å⁻¹
Current regularization parameter α current_alpha	0.0002
Highest regularization parameter α highest_alpha	72320000.0000
Real-space data points n_real_points	29
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.653; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.973; Smooth: 0.932

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Resolvase homolog YokA
Molecular weight formula_weight	63232.1 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C,I,K
Atom count atom_count	42532

MELKNIVNSYNITNILGYLRRSRQDMEREKRTGEDTLTEQKELMNKILTAIEIPYELKMEIGSGESIDGRPVFKECLKDLEEGKYQAIAVKEITRLSRGSYSDAGQIVNLLQSKRLIIITPYKVYDPRNPVDMRQIRFELFMAREEFEMTRERMTGAKYTYAAQGKWISGLAPYGYQLNKKTSKLDPVEDEAKVVQLIFNIFLNGLNGKDYSYTAIASHLTNLQIPTPSGKKRWNQYTIKAILQNEVYIGTVKYKVREKTKDGKRTIRPEKEQIVVQDAHAPIIDKEQFQQSQVKIANKVPLLPNKDEFELSELAGVCTCSKCGEPLSKYESKRIRKNKDGTESVYHVKSLTCKKNKCTYVRYNDVENAILDYLSSLNDLNDSTLTKHINSMLSKYEDDNSNMKTKKQMSEHLSQKEKELKNKENFIFDKYESGIYSDELFLKRKAALDEEFKELQNAKNELNGLQDTQSEIDSNTVRNNINKIIDQYHIESSSEKKNELLRMVLKDVIVNMTQKRKGPIPAQFEITPILRFNFIFDLTATNSFH

来源 Source

来源生物 organism	Bacillus subtilis
NCBI Class编号 ncbi_taxonomy_id	1423
宿主生物 host_organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

Entity 2 Entity 2 polymer

Description description	DNA (34-MER)
Molecular weight formula_weight	10433.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,M

TTTTTTTTGTAGTAAGTATCTTAATATACAGCTT

Entity 3 Entity 3 polymer

Description description	DNA (33-MER)
Molecular weight formula_weight	10161.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F,N

AGCTGTATATTAAGATACTTACTACAAAAAAAA

Entity 4 Entity 4 polymer

Description description	DNA (25-MER)
Molecular weight formula_weight	7656.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G,O

CATGTCATTAATATCAGTACAGATT

Entity 5 Entity 5 polymer

Description description	DNA (24-MER)
Molecular weight formula_weight	7382.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H,P

ATCTGTACTGATATTAATGACATG

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	4.69 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	44115

fit	/app/data/saxs_computation/dx/9dxh/9dxh.fit
pddf	/app/data/pr_computation/dx/9dxh/9dxh.pr.out
profile	/app/data/saxs_computation/dx/9dxh/9dxh.dat

attPmm and attBmm bound serine integrase complex in the pre-rotation state

1. Protein Identity and Related Structures Protein Identity & Related Structures

Resolvase homolog YokA

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)