SAXSdb — 9dxh

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Resolvase homolog YokA

Bacillus subtilis

UniProt O32006

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 8	DNA (34-MER) × 2 DNA (33-MER) × 2 DNA (25-MER) × 2 DNA (24-MER) × 2 ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	YOKA_BACSU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–545； UniProt 1–545 Author chain C； PDBConstruct 1–545； UniProt 1–545 Author chain I； PDBConstruct 1–545； UniProt 1–545 Author chain K； PDBConstruct 1–545； UniProt 1–545

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9dxh
Deposition date deposition_date	2024-10-11
Structure title title	attPmm and attBmm bound serine integrase complex in the pre-rotation state
Keywords keywords	Viral protein, Integrase, Recombinase, Complex, Recombination Directionality Factor, Integration, Excision, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9dxh__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9dxh__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9dxh__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	56.95 Å
Rg (electron density)	55.21 Å
Total Rg	55.45 Å
Atom count	42532
Residues	2372
Excluded volume	381380 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9dxh__assembly_1__model_1`	12-meric （12）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Resolvase homolog YokA
Molecular weight formula_weight	63232.1 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C,I,K
Atom count atom_count	42532

MELKNIVNSYNITNILGYLRRSRQDMEREKRTGEDTLTEQKELMNKILTAIEIPYELKMEIGSGESIDGRPVFKECLKDLEEGKYQAIAVKEITRLSRGSYSDAGQIVNLLQSKRLIIITPYKVYDPRNPVDMRQIRFELFMAREEFEMTRERMTGAKYTYAAQGKWISGLAPYGYQLNKKTSKLDPVEDEAKVVQLIFNIFLNGLNGKDYSYTAIASHLTNLQIPTPSGKKRWNQYTIKAILQNEVYIGTVKYKVREKTKDGKRTIRPEKEQIVVQDAHAPIIDKEQFQQSQVKIANKVPLLPNKDEFELSELAGVCTCSKCGEPLSKYESKRIRKNKDGTESVYHVKSLTCKKNKCTYVRYNDVENAILDYLSSLNDLNDSTLTKHINSMLSKYEDDNSNMKTKKQMSEHLSQKEKELKNKENFIFDKYESGIYSDELFLKRKAALDEEFKELQNAKNELNGLQDTQSEIDSNTVRNNINKIIDQYHIESSSEKKNELLRMVLKDVIVNMTQKRKGPIPAQFEITPILRFNFIFDLTATNSFH

Source Source

Source organism organism	Bacillus subtilis
NCBI taxonomy ID ncbi_taxonomy_id	1423
Host organism host_organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

Entity 2 Entity 2 polymer

Description description	DNA (34-MER)
Molecular weight formula_weight	10433.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,M

TTTTTTTTGTAGTAAGTATCTTAATATACAGCTT

Entity 3 Entity 3 polymer

Description description	DNA (33-MER)
Molecular weight formula_weight	10161.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F,N

AGCTGTATATTAAGATACTTACTACAAAAAAAA

Entity 4 Entity 4 polymer

Description description	DNA (25-MER)
Molecular weight formula_weight	7656.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G,O

CATGTCATTAATATCAGTACAGATT

Entity 5 Entity 5 polymer

Description description	DNA (24-MER)
Molecular weight formula_weight	7382.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H,P

ATCTGTACTGATATTAATGACATG

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	4.69 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	44115

attPmm and attBmm bound serine integrase complex in the pre-rotation state

1. Protein Identity and Related Structures Protein Identity & Related Structures

Resolvase homolog YokA

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9dxh__assembly_1__model_1

9dxh__assembly_1__model_1 | I(q)

9dxh__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)

attPmm and attBmm bound serine integrase complex in the pre-rotation state

1. Protein Identity and Related Structures Protein Identity & Related Structures

Resolvase homolog YokA

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9dxh__assembly_1__model_1

9dxh__assembly_1__model_1 | I(q)

9dxh__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)