SAXSdb — 9xzf

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polyribonucleotide nucleotidyltransferase 1, mitochondrial

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Homooligomer Protein × 3 RNA 1 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 46–783 Chain B； UniProt 46–783 Chain C； UniProt 46–783	Not recorded	RNA (31-MER) × 1 PO4 PHOSPHATE ION × 3	ELECTRON MICROSCOPY cryo-EM buffer：pH 8 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 2.65 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9XZF	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
3U1K Crystal structure of human PNPase Deposited 2011-09-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 46–669（624 aa） Fragment：UNP residues 46-669	Not recorded	CIT CITRIC ACID × 6	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5；298 K；10%(v/v) 2-Propanol, 0.1M Sodium citrate tribasic dihydrate, 26%(v/v) Polyethylene glycol 400 , pH 5.0, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.13 Å R-free 0.223
3U1K Crystal structure of human PNPase Deposited 2011-09-30	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain B 46–669（624 aa） Fragment：UNP residues 46-669 Chain C 46–669（624 aa） Fragment：UNP residues 46-669 Chain D 46–669（624 aa） Fragment：UNP residues 46-669	Not recorded	CIT CITRIC ACID × 6	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5；298 K；10%(v/v) 2-Propanol, 0.1M Sodium citrate tribasic dihydrate, 26%(v/v) Polyethylene glycol 400 , pH 5.0, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.13 Å R-free 0.223
5ZF6 Crystal structure of the dimeric human PNPase Deposited 2018-03-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 46–669（624 aa） Chain B 46–669（624 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；298.15 K；0.1M citrate buffer (pH 5.0), 10% (v/v) 2-propanol, 26% (v/v) polyethylene glycol 400	Resolution 2.80 Å R-free 0.249
9KJR The cryo-EM structure of human PNPase in the open conformation Deposited 2024-11-12	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 46–753（708 aa） Chain B 46–753（708 aa） Chain C 46–753（708 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.86 Å
9KJT The cryo-EM structure of human PNPase in the closed conformation Deposited 2024-11-12	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 46–783（738 aa） Chain B 46–783（738 aa） Chain C 46–783（738 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.84 Å
9NJB hPNPase RNA pre-catalytic state Deposited 2025-02-27	Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 3 PDB declaration: tetrameric	Chain A 46–783（738 aa） Chain B 46–783（738 aa） Chain C 46–783（738 aa）	Not recorded	SO4 SULFATE ION × 3 MG MAGNESIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.15 Å
9NJC hPNPase bound to PO4 in loop conformation 1 Deposited 2025-02-27	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 46–783（738 aa） Chain B 46–783（738 aa） Chain C 46–783（738 aa）	Not recorded	PO4 PHOSPHATE ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.36 Å
9NJD hPNPase bound to PO4 in loop conformation 3 Deposited 2025-02-27	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 46–783（738 aa） Chain B 46–783（738 aa） Chain C 46–783（738 aa）	Not recorded	PO4 PHOSPHATE ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.44 Å
9NJE hPNPase bound to PO4 in loop conformation 2 Deposited 2025-02-27	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 46–783（738 aa） Chain B 46–783（738 aa） Chain C 46–783（738 aa）	Not recorded	PO4 PHOSPHATE ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.44 Å
9NO0 hPNPase RNA loading state Deposited 2025-03-07	Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 3 PDB declaration: tetrameric	Chain A 46–783（738 aa） Chain B 46–783（738 aa） Chain C 46–783（738 aa）	Not recorded	PO4 PHOSPHATE ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.08 Å
9XYI hPNPase RNA loading state Deposited 2025-08-26	Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 3 PDB declaration: tetrameric	Chain A 46–783（738 aa） Chain B 46–783（738 aa） Chain C 46–783（738 aa）	Not recorded	SO4 SULFATE ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.46 Å

10 other PDB entries and 11 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	PNPT1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–739； UniProt 46–783 Author chain B； PDBConstruct 2–739； UniProt 46–783 Author chain C； PDBConstruct 2–739； UniProt 46–783

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9xzf
Deposition date deposition_date	2025-08-27
Structure title title	hPNPase RNA loading state with extended RNA in the bottom
Keywords keywords	;RNase, Protein-RNA Complex, RNA degradation, mitochondria, phosphorolytic enzyme, TRANSFERASE-RNA complex, RNA BINDING PROTEIN, RNA BINDING PROTEIN-RNA complex ;; RNA BINDING PROTEIN/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	36.69 Å
Radius of gyration Rg (electron density) rg_electron	35.99 Å
Forward intensity I(0) i0	648790000.00
Molecular weight molecular_weight	207410.0 kDa
Excluded volume excluded_volume	260090 Å³
Envelope volume envelope_volume	338750 Å³
Hydration-shell volume shell_volume	73560 Å³
Envelope diameter envelope_diameter	104.8 Å
Shell Rg shell_rg	45.85 Å
Envelope Rg envelope_rg	35.20 Å
Shape Rg shape_rg	35.99 Å
Total Rg total_rg	36.61 Å
Total atoms total_atoms	14555
Residues n_residues	1880
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	104.6 Å
Rg (real space) rg_real	36.35 Å
Rg uncertainty (real space) rg_real_error	0.36 Å
I(0) (real space) i0_real	6.4880e+08
I(0) uncertainty (real space) i0_real_error	7.9220e+06
Rg (reciprocal space) rg_reciprocal	36.56 Å
I(0) (reciprocal space) i0_reciprocal	648900000.0000
Solution quality estimate total_estimate	0.9025
Solution quality rating solution_quality	EXCELLENT a EXCELLENT solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	48.7 Å
Skewness Skewness skewness	-0.025
Kurtosis Kurtosis kurtosis	-0.640
Angular range angular_range	— – 0.2150 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	204000000.0000
Real-space data points n_real_points	44
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.968; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.958; Smooth: 0.867

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Polyribonucleotide nucleotidyltransferase 1, mitochondrial
Molecular weight formula_weight	84417.1 kDa
EC 编号 ec_number	2.7.7.8
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C
Atom count atom_count	14555

MAVAVDLGNRKLEISSGKLARFADGSAVVQSGDTAVMVTAVSKTKPSPSQFMPLVVDYRQKAAAAGRIPTNYLRREIGTSDKEILTSRIIDRSIRPLFPAGYFYDTQVLCNLLAVDGVNEPDVLAINGASVALSLSDIPWNGPVGAVRIGIIDGEYVVNPTRKEMSSSTLNLVVAGAPKSQIVMLEASAENILQQDFCHAIKVGVKYTQQIIQGIQQLVKETGVTKRTPQKLFTPSPEIVKYTHKLAMERLYAVFTDYEHDKVSRDEAVNKIRLDTEEQLKEKFPEADPYEIIESFNVVAKEVFRSIVLNEYKRCDGRDLTSLRNVSCEVDMFKTLHGSALFQRGQTQVLCTVTFDSLESGIKSDQVITAINGIKDKNFMLHYEFPPYATNEIGKVTGLNRRELGHGALAEKALYPVIPRDFPFTIRVTSEVLESNGSSSMASACGGSLALMDSGVPISSAVAGVAIGLVTKTDPEKGEIEDYRLLTDILGIEDYNGDMDFKIAGTNKGITALQADIKLPGIPIKIVMEAIQQASVAKKEILQIMNKTISKPRASRKENGPVVETVQVPLSKRAKFVGPGGYNLKKLQAETGVTISQVDEETFSVFAPTPSAMHEARDFITEICKDDQEQQLEFGAVYTATITEIRDTGVMVKLYPNMTAVLLHNTQLDQRKIKHPTALGLEVGQEIQVKYFGRDPADGRMRLSRKVLQSPATTVVRTLNDRSSIVMGEPISQSSSNSQSGSGSAWSHPQFEKGGGSGGGSGGSAWSHPQFEK

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Homo sapiens

Entity 2 Entity 2 polymer

Description description	RNA (31-MER)
Molecular weight formula_weight	9825.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	D

ACACAACACAACACACACCACACACACAUAA

Entity 3 Entity 3 non-polymer

Description description	PHOSPHATE ION
Molecular weight formula_weight	95.0 kDa
Source method src_method	syn
Copy count entity_count	3

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.650 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	2.65 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	89314

fit	/app/data/saxs_computation/xz/9xzf/9xzf.fit
pddf	/app/data/pr_computation/xz/9xzf/9xzf.pr.out
profile	/app/data/saxs_computation/xz/9xzf/9xzf.dat

hPNPase RNA loading state with extended RNA in the bottom

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polyribonucleotide nucleotidyltransferase 1, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)