← Back to search

9zdv

Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 51

Method: ELECTRON MICROSCOPY D_max: 160.7 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9zdv
deposition_date	2025-11-26
title	Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 51
keywords	RNase P RNA, Geobacillus stearothermophilus, catalytic RNA, cryo-EM structure, conformational heterogeneity, RNA; RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	46.24 Å
rg_electron	46.65 Å
i0	846175000.00
molecular_weight	136670.0 kDa
excluded_volume	127080 Å³
envelope_volume	235090 Å³
shell_volume	46313 Å³
envelope_diameter	170.0 Å
shell_rg	45.68 Å
envelope_rg	45.25 Å
shape_rg	46.64 Å
total_rg	46.65 Å
total_atoms	8999
n_residues	417
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	160.7 Å
rg_real	46.61 Å
rg_real_error	1.76 Å
i0_real	8.4620e+08
i0_real_error	1.7560e+07
rg_reciprocal	46.24 Å
i0_reciprocal	845800000.0000
total_estimate	0.8484
solution_quality	GOOD a GOOD solution
n_peaks	1
r_peak_primary	42.5 Å
skewness	0.462
kurtosis	-0.357
angular_range	— – 0.1700 Å⁻¹
current_alpha	0.0000
highest_alpha	24040000.0000
n_real_points	35
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.818; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.930; Smooth: 0.640

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (3)

Entity 1 polymer

description	RNase P RNA
formula_weight	135305.2 kDa
src_method	man
entity_count	1

Polymer

type	polyribonucleotide
strand_id	A
atom_count	9000

GUUAAUCAUGCUCGGGUAAUCGCUGCGGCCGGUUUCGGCCGUAGAGGAAAGUCCAUGCUCGCACGGUGCUGAGAUGCCCGUAGUGUUCGUGCCUAGCGAAUCCAUAAGCUAGGGCAGCCUGGCUUUGGCUGGGCUGACGGCGGGGAAAGAACCUACGUCCGGCUGGGAUAUGGUUCGAUUACCCUGAAAGUGCCACAGUGACGGAGCUCUAAGGGAAACCUUAGAGGUGGAACGCGGUAAACCCCACGAGCGAGAAACCCAAAUGAUGGUAGGGGCACCUUCCCGAAGGAAAUGAACGGAGGGAAGGACAGGCGGCGCAUGCAGCCUGUAGAUAGAUGAUUACCGCCGGAGUACGAGGCGCAAAGCCGCUUGCAGUACGAAGGUACAGAACAUGGCUUAUAGAGCAUGAUUAACGUC

Source

organism	Geobacillus stearothermophilus
ncbi_taxonomy_id	1422
host_organism	in vitro transcription vector pT7-TP(deltai)

Entity 2 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	37

Entity 3 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	3.300 Å
resolution_low	— Å
r_factor	—
r_work	—
r_free	—

resolution	3.30 Å
resolution_method	—
num_particles	82634

fit	/app/data/saxs_computation/zd/9zdv/9zdv.fit
pddf	/app/data/pr_computation/zd/9zdv/9zdv.pr.out
profile	/app/data/saxs_computation/zd/9zdv/9zdv.dat

Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 51

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

EM 3D