{ "code": "SASDX54", "status": "Published", "type_of_curve": "Co-flow SEC-SAS", "angular_unit": "1/A", "project": { "title": "Structural features within precursor microRNA-20a regulate Dicer-TRBP processing", "publication": { "title": "Structural features within precursor microRNA-20a regulate Dicer-TRBP processing", "author_list": "Liu Y, Harkner C, Westwood M, Munsayac A, Keane S", "journal": "Journal of Molecular Biology", "doi": "10.1016/j.jmb.2025.169317", "pmid": null, "published_date": "2025 Jul" }, "status": "released", "submitted_date": "2025-04-28", "released_date": "2025-07-03" }, "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDX54.out", "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDX54.dat", "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDX54_dat_img.png", "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDX54_kratky_img.png", "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDX54_pofr_img.png", "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDX54_guinier_img.png", "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDX54.sascif", "experiment": { "instrument": { "detector": { "type": null, "name": "Eiger2 XE 9M", "resolution": 72.0 }, "name": "Advanced Photon Source (APS), Argonne National Laboratory", "city": "Lemont, IL", "country": "USA", "beamline_name": "BioCAT 18ID", "beam_geometry": null, "type_of_source": "X-ray synchrotron", "point_source": null, "line_collimation": null, "sample_path_length": null, "line_collimation_slitlength": null, "line_collimation_integrationwidth": null, "xray_energy": null, "beam_profile_ah": null, "beam_profile_al": null }, "sample": { "molecule": [ { "long_name": "Precursor microRNA 20a", "short_name": "pre-miR-20a", "sequence": "GGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGCC", "organism": "Homo sapiens", "uniprot_code": null, "uniprot_range_first": null, "uniprot_range_last": null, "oligomerization": "monomer", "molecular_type": "RNA", "uniprot_sequence": "", "mw": 23.481, "total_mw": 23.481, "number_molecules": 1, "complex_state": false, "deuteration": null, "molecule_source": "biological", "molecule_description": "NMR/SAXS construct of pre-miR-20a. An additional non-native G-C base pair is added at the ends of the RNA to stabilize the fold." } ], "buffer": { "name": "50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl, 5 mM BME", "concentration_unit": null, "comment": null, "additive": null, "concentration": null, "pka": null, "ph": 7.5, "deuteration": null }, "purity_method": null, "name": "Precursor microRNA 20a (pre-miR-20a)", "ext_coefficient": null, "contrast": null, "specific_vol": null, "dry_vol": null, "absorbption": null, "deuteration": null, "mixture": null }, "contributor": [ { "affiliation": [ { "short_name": null, "address": null, "full_name": "University of Michigan", "webpage": null } ], "contributor_name": "Aldrex", "contributor_surname": "Munsayac", "orcid": "https://orcid.org/0000-0001-7268-020X" } ], "concentration_method": null, "concentration_unit": null, "date": "2022-10-08", "storage_temperature": 4.0, "cell_temperature": 22.0, "exposure_time": 0.5, "number_of_frames": 36, "wavelength": 0.1033, "sample_detector_distance": 3.663, "concentration_min": null, "concentration_max": 1.3, "sample_volume": 260.0, "flow_rate": 0.6, "s_min": 0.029, "s_max": 4.201, "total_exposure_time": null, "seccolumn": 3 }, "fits": [ { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDX54_fit1_model1_img.png", "software": "AMBER", "pdb_link": [], "model_title": null, "type_of_model": "atomic", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDX54_fit1_model1.pdb", "model_mw": 22.54, "bead_radius": null, "log": null, "symmetry": null, "comment": null, "user": 788 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDX54_fit1_fitfoxs_img.png", "software": "FoXS", "chi_square_value": 0.878543, "p_value": 0.811, "fit_residual_plot": "SASDX54_fit1_fitfoxsresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDX54_fit1.dat", "fit_log": null, "software_version": null, "description": "" }, { "models": [ { "model_plot": null, "software": "DENSS", "pdb_link": [], "model_title": null, "type_of_model": "density", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDX54_fit2_model1.mrc", "model_mw": null, "bead_radius": null, "log": null, "symmetry": null, "comment": null, "user": 788 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDX54_fit2_fixed_fit_img.png", "software": "DENSS", "chi_square_value": 0.0201, "p_value": 1.0, "fit_residual_plot": "SASDX54_fit2_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDX54_fit2.fit", "fit_log": null, "software_version": null, "description": "" } ], "estimated_volume_method": null, "pddf_software": "ATSAS GNOM", "pddf_software_version": "5.0", "i0_calibration_standard": null, "description": "NMR/SAXS construct of pre-miR-20a. An additional non-native G-C base pair is added at the ends of the RNA to stabilize the fold.", "experiment_description": "Synchrotron SAXS data from solutions of precursor microRNA 20a in 50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl, 5 mM BME, pH 7.5 were collected on the BioCAT 18ID beam line at the Advanced Photon Source (APS), Argonne National Laboratory (Lemont, IL, USA) using a Eiger2 XE 9M detector at a sample-detector distance of 3.7 m and at a wavelength of λ = 0.1033 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. The SEC parameters were as follows: A 260.00 μl sample at 1.3 mg/ml was injected at a 0.60 ml/min flow rate onto a GE Superdex 75 Increase 10/300 column at 22°C. 36 successive 0.500 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.", "tags": [], "intensity_unit": "arbitrary", "experimental_mw": 25.2, "experimental_mw_error": null, "guinier_i0_mw": null, "guinier_i0_mw_error": null, "porod_mw": null, "porod_mw_error": null, "pddf_i0": 0.008425, "pddf_i0_error": null, "guinier_i0": 0.0084136, "guinier_i0_error": null, "pddf_rg": 3.13, "pddf_rg_error": null, "guinier_rg": 3.057, "guinier_rg_error": 0.17, "pddf_dmax": 11.2, "pddf_dmax_error": null, "porod_volume": 32.0, "porod_volume_error": null, "estimated_volume": null, "estimated_volume_error": null, "guinier_point_first": 11, "guinier_point_last": 244, "pddf_point_first": null, "pddf_point_last": null, "i0_calibration_standard_data": null, "intensities_log_log_plot": "SASDX54_datloglog_img.png", "symmetry": null, "last_modified": "2025-07-03T00:12:17.108560+02:00", "bragg_peak": [] }