{ "code": "SASDV93", "status": "Published", "type_of_curve": "Merged", "angular_unit": "1/A", "project": { "title": "Cleavage region organizes the structural architecture of the SINE-derived B2 repressive ribozyme.", "publication": { "title": "Cleavage region organizes the structural architecture of the SINE-derived B2 repressive ribozyme.", "author_list": "Singhal A, Mrozowich T, Rivera C, Chaudhury SN, Xu L, Aguilar R, Badmalia M, Lee JT, Patel TR, Sanbonmatsu KY", "journal": "Commun Biol", "doi": "10.1038/s42003-026-09819-0", "pmid": "41872304", "published_date": "2026 Mar 23" }, "status": "released", "submitted_date": "2024-06-24", "released_date": "2026-02-04" }, "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDV93.out", "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDV93.dat", "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDV93_dat_img.png", "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDV93_kratky_img.png", "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDV93_pofr_img.png", "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDV93_guinier_img.png", "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDV93.sascif", "experiment": { "instrument": { "detector": { "type": null, "name": "Eiger 4M", "resolution": 75.0 }, "name": "Diamond Light Source", "city": "Didcot", "country": "UK", "beamline_name": "B21", "beam_geometry": null, "type_of_source": "X-ray synchrotron", "point_source": null, "line_collimation": null, "sample_path_length": null, "line_collimation_slitlength": null, "line_collimation_integrationwidth": null, "xray_energy": null, "beam_profile_ah": null, "beam_profile_al": null }, "sample": { "molecule": [ { "long_name": "B2 short interspaced nuclear element (SINE) RNA with two point mutations", "short_name": "B2J", "sequence": "GGGCUGGUGAGAUGGCUCAGUGGGUAAGAGCACCCGACUGCUCUUCCGAAGGUCCGGAGUUCAAAUCCCAGCAACCACAUGGUGGCUCACAACCAUCCGUAACGAGAUCUGACUCCCUCUUCUGGAGUGUCUGAAGACAGCUACAGUGUACUUACAUAUAAUAAAUAAAUAAAUCUUU", "organism": "Mus musculus", "uniprot_code": null, "uniprot_range_first": null, "uniprot_range_last": null, "oligomerization": "monomer", "molecular_type": "RNA", "uniprot_sequence": "", "mw": 57.225, "total_mw": 57.225, "number_molecules": 1, "complex_state": false, "deuteration": null, "molecule_source": "biological", "molecule_description": "B2 SINE ribozyme with two point mutations (A55C and U114C)." } ], "buffer": { "name": "5 mM Tris-HCl, 10 mM NaCl, 0.01% NP-40, 0.02 mM EDTA, 0.2 mM DTT, 0.5 mM MgCl2 and 1.5 % Glycerol", "concentration_unit": null, "comment": null, "additive": null, "concentration": null, "pka": null, "ph": 7.9, "deuteration": null }, "purity_method": null, "name": "B2 SINE ribozyme with B2J Mutation", "ext_coefficient": null, "contrast": null, "specific_vol": null, "dry_vol": null, "absorbption": null, "deuteration": null, "mixture": null }, "contributor": [ { "affiliation": [ { "short_name": null, "address": "Lethbridge, AB, Canada", "full_name": "University of Lethbridge", "webpage": "http://www.uleth.ca/" } ], "contributor_name": "Trushar", "contributor_surname": "Patel", "orcid": null } ], "concentration_method": null, "concentration_unit": null, "date": "2021-02-20", "storage_temperature": 4.0, "cell_temperature": 15.0, "exposure_time": 3.0, "number_of_frames": 600, "wavelength": 0.094, "sample_detector_distance": 3.7, "concentration_min": 1.6, "concentration_max": 1.6, "sample_volume": null, "flow_rate": null, "s_min": 0.064, "s_max": 3.399, "total_exposure_time": null, "seccolumn": null }, "fits": [ { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDV93_fit1_model1_img.png", "software": "DAMMIN", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDV93_fit1_model1.pdb", "model_mw": null, "bead_radius": 4.5, "log": null, "symmetry": null, "comment": null, "user": 239 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDV93_fit1_fixed_fit_img.png", "software": "DAMMIN", "chi_square_value": 1.382, "p_value": 0.1154, "fit_residual_plot": "SASDV93_fit1_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDV93_fit1.fir", "fit_log": null, "software_version": null, "description": "" }, { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDV93_fit2_model1_img.png", "software": "DAMMIN", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDV93_fit2_model1.pdb", "model_mw": null, "bead_radius": 4.5, "log": null, "symmetry": null, "comment": null, "user": 239 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDV93_fit2_fixed_fit_img.png", "software": "DAMMIN", "chi_square_value": 1.383, "p_value": 0.1154, "fit_residual_plot": "SASDV93_fit2_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDV93_fit2.fir", "fit_log": null, "software_version": null, "description": "" }, { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDV93_fit3_model1_img.png", "software": "DAMMIN", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDV93_fit3_model1.pdb", "model_mw": null, "bead_radius": 4.5, "log": null, "symmetry": null, "comment": null, "user": 239 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDV93_fit3_fixed_fit_img.png", "software": "DAMMIN", "chi_square_value": 1.386, "p_value": 0.1154, "fit_residual_plot": "SASDV93_fit3_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDV93_fit3.fir", "fit_log": null, "software_version": null, "description": "" } ], "estimated_volume_method": null, "pddf_software": "ATSAS GNOM", "pddf_software_version": "5.0", "i0_calibration_standard": null, "description": null, "experiment_description": "Synchrotron SAXS data from solutions of B2 SINE ribozyme with deletion mutation 81-124 in 5 mM Tris-HCl, 10 mM NaCl, 0.01% NP-40, 0.02 mM EDTA, 0.2 mM DTT, 0.5 mM MgCl2 and 1.5 % Glycerol, pH 7.9 were collected on the B21 beam line at the Diamond Light Source storage ring (Didcot, UK) using a Eiger 4M detector at a sample-detector distance of 3.7 m and at a wavelength of λ = 0.094 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. A sample at 1.6 mg/ml was injected into a Shodex 403KW-4F HPLC column at 15°C using a flow rate of 0.16 ml/min. 600 successive 3 second frames were collected. Eight successive 3 second frames were selected through the SEC elution peak of the sample. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. The low angle data collected at lower concentration were merged with the high-concentration high-angle data to yield the final composite scattering curve.", "tags": [], "intensity_unit": "arbitrary", "experimental_mw": 72.1, "experimental_mw_error": null, "guinier_i0_mw": null, "guinier_i0_mw_error": null, "porod_mw": 74.0, "porod_mw_error": null, "pddf_i0": 0.02701, "pddf_i0_error": null, "guinier_i0": 0.027105, "guinier_i0_error": null, "pddf_rg": 5.6, "pddf_rg_error": null, "guinier_rg": 5.496, "guinier_rg_error": 0.242, "pddf_dmax": 17.31, "pddf_dmax_error": null, "porod_volume": 136.0, "porod_volume_error": null, "estimated_volume": null, "estimated_volume_error": null, "guinier_point_first": 4, "guinier_point_last": 131, "pddf_point_first": null, "pddf_point_last": null, "i0_calibration_standard_data": null, "intensities_log_log_plot": "SASDV93_datloglog_img.png", "symmetry": null, "last_modified": "2026-03-24T13:41:48.771992+01:00", "bragg_peak": [] }