{
  "code": "SASDVA7",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/A",
  "project": {
    "title": "Probing the statistics of sequence-dependent DNA conformations in solution using SAXS.",
    "publication": {
      "title": "Probing the statistics of sequence-dependent DNA conformations in solution using SAXS.",
      "author_list": "Koning HJ, Pullakhandam A, Whitten AE, Bond CS, Peyrard M",
      "journal": "Acta Crystallogr D Struct Biol",
      "doi": "10.1107/S2059798325011556",
      "pmid": "41553140",
      "published_date": "2026 Feb 1"
    },
    "status": "released",
    "submitted_date": "2024-09-18",
    "released_date": "2025-08-12"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDVA7.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDVA7.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVA7_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVA7_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDVA7_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVA7_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDVA7.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus3 S 2M",
        "resolution": 172.0
      },
      "name": "Australian Synchrotron",
      "city": "Melbourne",
      "country": "Australia",
      "beamline_name": "SAXS/WAXS",
      "beam_geometry": null,
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "GAGE6_3",
          "short_name": "GAGE6_3",
          "sequence": "GCCTTCTGCAAAGAAGTCTTGCGCATCGCGCGTGAAGGCGCGCGCTAGCGCGCGGATGCT",
          "organism": "Homo sapiens",
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "dimer",
          "molecular_type": "DNA",
          "uniprot_sequence": "",
          "mw": 18.615,
          "total_mw": 37.23,
          "number_molecules": 2,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": "GAGE6_3 duplex \r\n\r\n5-GCCTTCTGCAAAGAAGTCTTGCGCATCGCGCGTGAAGGCGCGCGCTAGCGCGCGGATGCT-3"
        }
      ],
      "buffer": {
        "name": "150 mM KCl, 20 mM HEPES, 5% glycerol, 5 mM MgCl2, 1 mM DTT",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.5,
        "deuteration": null
      },
      "purity_method": null,
      "name": "The 60bp dsDNA oligo GAGE6_3",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": null,
            "full_name": "The University of Western Australia",
            "webpage": null
          }
        ],
        "contributor_name": "Heidar",
        "contributor_surname": "Koning",
        "orcid": ""
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2023-11-28",
    "storage_temperature": 25.0,
    "cell_temperature": 25.0,
    "exposure_time": 1.0,
    "number_of_frames": 400,
    "wavelength": 0.10781,
    "sample_detector_distance": 2.39,
    "concentration_min": null,
    "concentration_max": 3.01,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.068,
    "s_max": 6.235,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": "5.0",
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of The 60bp dsDNA oligo GAGE6_2 in 150 mM KCl, 20 mM HEPES, 5% glycerol, 5 mM MgCl2, 1 mM DTT, pH 7.5 were collected on the SAXS/WAXS beam line at the Australian Synchrotron storage ring (Melbourne, Australia) using a Pilatus3 S 2M detector at a sample-detector distance of 2.4 m and at a wavelength of λ = 0.10781 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). One 50 µl solute concentration of 2.78 mg/ml was measured at 25°C. 400 successive 1 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. This data is part of the manuscript 'Probing the statistics of sequence-dependent DNA conformations in solution using SAXS'. 2sigma errors from the Australian Synchrotron's SAXS/WAXS beamline have been divided by 2 to be compatible with expectations from the ATSAS package.\r\n\r\n5-GCCTTCTGCAAAGAAGTCTTGCGCATCGCGCGTGAAGGCGCGCGCTAGCGCGCGGATGCT-3\r\n: The 60bp dsDNA duplex GAGE6_3",
  "tags": [],
  "intensity_unit": "1/cm",
  "experimental_mw": 34.495,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": 150.0,
  "porod_mw_error": null,
  "pddf_i0": 0.01555,
  "pddf_i0_error": null,
  "guinier_i0": 0.0150943,
  "guinier_i0_error": null,
  "pddf_rg": 5.59,
  "pddf_rg_error": null,
  "guinier_rg": 5.025,
  "guinier_rg_error": 0.884,
  "pddf_dmax": 21.4,
  "pddf_dmax_error": null,
  "porod_volume": 80.0,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 1,
  "guinier_point_last": 22,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDVA7_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2026-02-23T09:45:38.531837+01:00",
  "bragg_peak": []
}