{ "code": "SASDBF2", "status": "Published", "type_of_curve": "Single concentration", "angular_unit": "1/nm", "project": { "title": "Wing phosphorylation is a major functional determinant of the Lrs14-type biofilm and motility regulator AbfR1 in Sulfolobus acidocaldarius.", "publication": { "title": "Wing phosphorylation is a major functional determinant of the Lrs14-type biofilm and motility regulator AbfR1 in Sulfolobus acidocaldarius.", "author_list": "Li L, Banerjee A, Bischof LF, Maklad HR, Hoffmann L, Henche AL, Veliz F, Bildl W, Schulte U, Orell A, Essen LO, Peeters E, Albers SV", "journal": "Mol Microbiol", "doi": "10.1111/mmi.13735", "pmid": "28628237", "published_date": "2017 Sep" }, "status": "released", "submitted_date": "2015-10-01", "released_date": "2017-05-23" }, "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDBF2.out", "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDBF2.dat", "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBF2_dat_img.png", "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBF2_kratky_img.png", "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDBF2_pofr_img.png", "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBF2_guinier_img.png", "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBF2.sascif", "experiment": { "instrument": { "detector": { "type": "Dectris", "name": "Pilatus 1M", "resolution": 172.0 }, "name": "ESRF", "city": "Grenoble", "country": "France", "beamline_name": "BM29", "beam_geometry": "", "type_of_source": "X-ray synchrotron", "point_source": null, "line_collimation": null, "sample_path_length": null, "line_collimation_slitlength": null, "line_collimation_integrationwidth": null, "xray_energy": null, "beam_profile_ah": null, "beam_profile_al": null }, "sample": { "molecule": [ { "long_name": "40bp long dsDNA-Sa Oligonucleotide", "short_name": "dsDNA-Sa Oligo", "sequence": "GTAGTAAGATTTAAAAAAACATACTAAGATATAAATTAAC\r\n", "organism": null, "uniprot_code": null, "uniprot_range_first": null, "uniprot_range_last": null, "oligomerization": "monomer", "molecular_type": "DNA", "uniprot_sequence": null, "mw": 24.7, "total_mw": 24.7, "number_molecules": 1, "complex_state": false, "deuteration": null, "molecule_source": "biological", "molecule_description": null } ], "buffer": { "name": "0.5 x Tris/Borate/EDTA (TBE)", "concentration_unit": "v/v", "comment": null, "additive": null, "concentration": 0.5, "pka": null, "ph": null, "deuteration": null }, "purity_method": null, "name": "Solution structure of 40bp long dsDNA-Sa Oligonucleotide", "ext_coefficient": null, "contrast": null, "specific_vol": null, "dry_vol": null, "absorbption": null, "deuteration": null, "mixture": null }, "contributor": [ { "affiliation": [ { "short_name": null, "address": "Marburg, Germany", "full_name": "Philipps-Universität Marburg", "webpage": "" } ], "contributor_name": "Ankan", "contributor_surname": "Banerjee", "orcid": null } ], "concentration_method": null, "concentration_unit": "mg/ml", "date": "2015-08-28", "storage_temperature": 4.0, "cell_temperature": 4.0, "exposure_time": 10.0, "number_of_frames": 20, "wavelength": 0.93, "sample_detector_distance": 2.43, "concentration_min": null, "concentration_max": 1.0, "sample_volume": null, "flow_rate": null, "s_min": 0.033, "s_max": 4.934, "total_exposure_time": null, "seccolumn": null }, "fits": [ { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDBF2_fit1_model1_img.png", "software": "DAMMIN", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": "", "model_data": "https://www.sasbdb.org/media/pdb_file/SASDBF2_fit1_model1.pdb", "model_mw": null, "bead_radius": 2.5, "log": null, "symmetry": "", "comment": "", "user": 72 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDBF2_fit1_fit_img.png", "software": null, "chi_square_value": 1.461, "p_value": 0.0, "fit_residual_plot": "SASDBF2_fit1_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDBF2_fit1.fir", "fit_log": null, "software_version": null, "description": null } ], "estimated_volume_method": null, "pddf_software": "ATSAS GNOM", "pddf_software_version": null, "i0_calibration_standard": null, "description": null, "experiment_description": "X-ray synchrotron radiation scattering data from solutions of SaOligo (40bp long dsDNA) in 0.5 x TBE was collected on the BM29 beam line on the storage ring ESRF (Grenoble, France) using a 2D Photon counting Pilatus 1M pixel detector (s = 4π sin θ/λ, where 2θ is the scattering angle). A single 1 mg/mL concentration was measured. 10 successive 20 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. The analysis was performed using the ATSAS package. The displayed model is an averaged and volume corrected dummy atom representation (DAMFILT).", "tags": [], "intensity_unit": null, "experimental_mw": 82.0, "experimental_mw_error": null, "guinier_i0_mw": null, "guinier_i0_mw_error": null, "porod_mw": 18.3, "porod_mw_error": null, "pddf_i0": 82.41, "pddf_i0_error": null, "guinier_i0": 82.0, "guinier_i0_error": null, "pddf_rg": 3.55, "pddf_rg_error": null, "guinier_rg": 3.56, "guinier_rg_error": null, "pddf_dmax": 12.0, "pddf_dmax_error": null, "porod_volume": null, "porod_volume_error": null, "estimated_volume": null, "estimated_volume_error": null, "guinier_point_first": 16, "guinier_point_last": 57, "pddf_point_first": null, "pddf_point_last": null, "i0_calibration_standard_data": null, "intensities_log_log_plot": "SASDBF2_datloglog_img.png", "symmetry": null, "last_modified": "2019-12-06T13:07:15.624532+01:00", "bragg_peak": [] }