{ "code": "SASDDH5", "status": "Published", "type_of_curve": "Merged", "angular_unit": "1/nm", "project": { "title": "Octa-repeat domain of the mammalian prion protein mRNA forms stable A-helical hairpin structure rather than G-quadruplexes.", "publication": { "title": "Octa-repeat domain of the mammalian prion protein mRNA forms stable A-helical hairpin structure rather than G-quadruplexes.", "author_list": "Czech A, Konarev PV, Goebel I, Svergun DI, Wills PR, Ignatova Z", "journal": "Sci Rep", "doi": "10.1038/s41598-019-39213-2", "pmid": "30792490", "published_date": "2019 Feb 21" }, "status": "released", "submitted_date": "2018-03-29", "released_date": "2019-02-25" }, "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDDH5.out", "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDDH5.dat", "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDDH5_dat_img.png", "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDDH5_kratky_img.png", "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDDH5_pofr_img.png", "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDDH5_guinier_img.png", "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDDH5.sascif", "experiment": { "instrument": { "detector": { "type": null, "name": "Pilatus 2M", "resolution": null }, "name": "PETRA III", "city": "DESY; Hamburg", "country": "Germany", "beamline_name": "EMBL P12", "beam_geometry": null, "type_of_source": "X-ray synchrotron", "point_source": null, "line_collimation": null, "sample_path_length": null, "line_collimation_slitlength": null, "line_collimation_integrationwidth": null, "xray_energy": null, "beam_profile_ah": null, "beam_profile_al": null }, "sample": { "molecule": [ { "long_name": "octo-repeat PrP mRNA", "short_name": "PrPmRNA", "sequence": "AACACUGGGGGCAGCCGAUACCCGGGGCAGGGCAGCCCUGGAGGCAACCGCUACCCACCUCAGGGCGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGGGCAGCCCCAUGGUGGUGGCUGGGGACAGCCUCAUGGUGGUGGCUGGGGUCAAGGAGGUGGCACCCAC\r\nCUCAGGGCGGUGGUGGCUGGGGGCC", "organism": "human PrP ORF", "uniprot_code": null, "uniprot_range_first": null, "uniprot_range_last": null, "oligomerization": "dimer", "molecular_type": "RNA", "uniprot_sequence": null, "mw": 71.89, "total_mw": 143.78, "number_molecules": 2, "complex_state": false, "deuteration": null, "molecule_source": "biological", "molecule_description": null } ], "buffer": { "name": "10 mM Tris buffer with 100 mM KCl", "concentration_unit": null, "comment": null, "additive": null, "concentration": null, "pka": null, "ph": 7.5, "deuteration": null }, "purity_method": null, "name": "Mammalian prion protein mRNA (PrP mRNA wild type) with KCl", "ext_coefficient": null, "contrast": null, "specific_vol": null, "dry_vol": null, "absorbption": null, "deuteration": null, "mixture": null }, "contributor": [ { "affiliation": [ { "short_name": "EMBL-Hamburg", "address": "Notkestraße 85, Geb. 25A, 22607 Hamburg, Deutschland, Germany", "full_name": "European Molecular Biology Laboratory (EMBL) - Hamburg outstation", "webpage": "http://www.embl-hamburg.de/index.php" } ], "contributor_name": "Petr", "contributor_surname": "Konarev", "orcid": null } ], "concentration_method": null, "concentration_unit": null, "date": "2017-06-06", "storage_temperature": 20.0, "cell_temperature": 20.0, "exposure_time": 0.05, "number_of_frames": 20, "wavelength": 0.124, "sample_detector_distance": 3.1, "concentration_min": 0.5, "concentration_max": 4.0, "sample_volume": null, "flow_rate": null, "s_min": 0.116, "s_max": 5.033, "total_exposure_time": null, "seccolumn": null }, "fits": [ { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDDH5_fit1_model1_img.png", "software": "DAMFILT", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": "5.0", "model_data": "https://www.sasbdb.org/media/pdb_file/SASDDH5_fit1_model1.pdb", "model_mw": null, "bead_radius": 7.0, "log": null, "symmetry": null, "comment": null, "user": 88 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDDH5_fit1_fit_img.png", "software": "DAMMIF", "chi_square_value": 1.257, "p_value": 0.023422, "fit_residual_plot": "SASDDH5_fit1_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDDH5_fit1.fir", "fit_log": null, "software_version": null, "description": null } ], "estimated_volume_method": null, "pddf_software": "ATSAS GNOM", "pddf_software_version": "4.6", "i0_calibration_standard": null, "description": null, "experiment_description": "Synchrotron SAXS data from solutions of mammalian prion protein mRNA (PrP mRNA wild type) in 10 mM Tris buffer with 100 mM KCl, pH 7.5 were collected on the EMBL-P12 beam line at the PETRA III storage ring (DESY, Hamburg, Germany) using a Pilatus 2M detector at a sample-detector distance of 3.1 m and at a wavelength of λ = 0.124 nm (l(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). Solute concentrations ranging between 0.5 and 4 mg/ml were measured at 20°C. 20 successive 0.050 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. The low angle data collected at lower concentration were merged with the highest concentration high angle data to yield the final composite scattering curve.", "tags": [], "intensity_unit": "arbitrary", "experimental_mw": 180.0, "experimental_mw_error": null, "guinier_i0_mw": 180.0, "guinier_i0_mw_error": 20.0, "porod_mw": 220.0, "porod_mw_error": null, "pddf_i0": 123800.0, "pddf_i0_error": null, "guinier_i0": 122435.0, "guinier_i0_error": 1243.0, "pddf_rg": 9.3, "pddf_rg_error": 0.1, "guinier_rg": 8.81, "guinier_rg_error": 0.09, "pddf_dmax": 31.0, "pddf_dmax_error": 1.0, "porod_volume": 240.0, "porod_volume_error": null, "estimated_volume": null, "estimated_volume_error": null, "guinier_point_first": 1, "guinier_point_last": 14, "pddf_point_first": null, "pddf_point_last": null, "i0_calibration_standard_data": null, "intensities_log_log_plot": "SASDDH5_datloglog_img.png", "symmetry": null, "last_modified": "2023-06-21T07:56:39.492710+02:00", "bragg_peak": [] }