{ "code": "SASDXH7", "status": "Published", "type_of_curve": "Single concentration", "angular_unit": "1/A", "project": { "title": "Probing the statistics of sequence-dependent DNA conformations in solution using SAXS.", "publication": { "title": "Probing the statistics of sequence-dependent DNA conformations in solution using SAXS.", "author_list": "Koning HJ, Pullakhandam A, Whitten AE, Bond CS, Peyrard M", "journal": "Acta Crystallogr D Struct Biol", "doi": "10.1107/S2059798325011556", "pmid": "41553140", "published_date": "2026 Feb 1" }, "status": "released", "submitted_date": "2024-09-18", "released_date": "2025-08-12" }, "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDXH7.out", "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDXH7.dat", "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDXH7_dat_img.png", "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDXH7_kratky_img.png", "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDXH7_pofr_img.png", "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDXH7_guinier_img.png", "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDXH7.sascif", "experiment": { "instrument": { "detector": { "type": "Dectris", "name": "Pilatus 1M", "resolution": 172.0 }, "name": "Australian Synchrotron", "city": "Melbourne", "country": "Australia", "beamline_name": "SAXS/WAXS", "beam_geometry": "Point", "type_of_source": "X-ray synchrotron", "point_source": true, "line_collimation": null, "sample_path_length": null, "line_collimation_slitlength": null, "line_collimation_integrationwidth": null, "xray_energy": null, "beam_profile_ah": null, "beam_profile_al": null }, "sample": { "molecule": [ { "long_name": "GAGE6 60bp dsDNA oligo", "short_name": "GAGE6 oligo", "sequence": "GCCTTCTGCAAAGAAGTCTTGCGCATCTTTTGTGAAGTTTATTTCTAGCTTTTTGATGCT", "organism": "Homo sapiens", "uniprot_code": null, "uniprot_range_first": null, "uniprot_range_last": null, "oligomerization": "monomer", "molecular_type": "DNA", "uniprot_sequence": "", "mw": 37.101, "total_mw": 37.101, "number_molecules": 1, "complex_state": false, "deuteration": null, "molecule_source": "biological", "molecule_description": "60 bp GAGE6 dsDNA oligonucleotide from the study 'insight into the Tumor Suppression Mechanism from the Structure of Human Polypyrimidine Splicing Factor (PSF/SFPQ) Complexed with a 30mer RNA from Murine Virus-like 30S Transcript‑1' (Wang et al, 2022)." } ], "buffer": { "name": "150 mM KCl, 20 mM HEPES, 5% glycerol, 5 mM MgCl2, 1 mM DTT", "concentration_unit": null, "comment": null, "additive": null, "concentration": null, "pka": null, "ph": 7.5, "deuteration": null }, "purity_method": null, "name": "GAGE6 60bp dsDNA oligonucleotide", "ext_coefficient": null, "contrast": null, "specific_vol": null, "dry_vol": null, "absorbption": null, "deuteration": null, "mixture": null }, "contributor": [ { "affiliation": [ { "short_name": null, "address": null, "full_name": "The University of Western Australia", "webpage": null } ], "contributor_name": "Heidar", "contributor_surname": "Koning", "orcid": "" } ], "concentration_method": null, "concentration_unit": null, "date": "2023-03-14", "storage_temperature": null, "cell_temperature": null, "exposure_time": null, "number_of_frames": null, "wavelength": null, "sample_detector_distance": null, "concentration_min": null, "concentration_max": null, "sample_volume": null, "flow_rate": null, "s_min": 0.045, "s_max": 4.921, "total_exposure_time": null, "seccolumn": null }, "fits": [ { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDXH7_fit1_model1_img.png", "software": "DAMMIN", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": "ATSAS online", "model_data": "https://www.sasbdb.org/media/pdb_file/SASDXH7_fit1_model1.pdb", "model_mw": null, "bead_radius": null, "log": "https://www.sasbdb.org/media/log_files/GAGE6_2.log", "symmetry": "P1", "comment": "DAMMAVER search area used in DAMMIN", "user": 726 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDXH7_fit1_fixed_fit_img.png", "software": "DAMMIN", "chi_square_value": 0.357, "p_value": 0.6005, "fit_residual_plot": "SASDXH7_fit1_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDXH7_fit1.fir", "fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/GAGE6_2.log", "software_version": "ATSAS online", "description": "DAMMAVER search envelope which had some curvature used as a search model in DAMMIN" } ], "estimated_volume_method": null, "pddf_software": "ATSAS GNOM", "pddf_software_version": "5.0", "i0_calibration_standard": null, "description": "Data was collected at the SAXS/WAXS beam line at the Australian Synchrotron (Melbourne, Australia) using a Pilatus3 S 2M detector at a sample-detector distance of 2.68 m and at a wavelength of λ = 0.107812 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. The SEC parameters were as follows: A 50 μl sample at 2.587 mg/ml was injected onto a GE Superdex 200 5/150 column at 25°C using 150 mM KCl, 20 mM HEPES (pH 7.4), 5 mM MgCl2, 1 mM DTT, 5% glycerol buffer. 400 successive 1 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. 2sigma errors from the Australian Synchrotron's SAXS/WAXS beamline have been divided by 2 to be compatible with expectations from the ATSAS package\r\n\r\nThis is the 60 bp GAGE6 oligo from Lee et al (2015); Wang et al (2022) which reportedly binds SFPQ. SAXS analysis indicates some degree of curvature which is likely due to the presence of multiple AT repeat regions in the sequence.", "experiment_description": null, "tags": [], "intensity_unit": "arbitrary", "experimental_mw": 33.1, "experimental_mw_error": null, "guinier_i0_mw": null, "guinier_i0_mw_error": null, "porod_mw": 63.0, "porod_mw_error": null, "pddf_i0": 0.005087, "pddf_i0_error": null, "guinier_i0": 0.00486542, "guinier_i0_error": null, "pddf_rg": 5.52, "pddf_rg_error": null, "guinier_rg": 4.785, "guinier_rg_error": 2.34, "pddf_dmax": 19.5, "pddf_dmax_error": null, "porod_volume": 101.0, "porod_volume_error": null, "estimated_volume": null, "estimated_volume_error": null, "guinier_point_first": 3, "guinier_point_last": 33, "pddf_point_first": null, "pddf_point_last": null, "i0_calibration_standard_data": null, "intensities_log_log_plot": "SASDXH7_datloglog_img.png", "symmetry": null, "last_modified": "2026-02-23T09:45:35.560463+01:00", "bragg_peak": [] }