{ "code": "SASDWR5", "status": "Published", "type_of_curve": "SEC-SAS", "angular_unit": "1/nm", "project": { "title": "A new protein-dependent riboswitch activates ribosomal frameshifting", "publication": { "title": "A new protein-dependent riboswitch activates ribosomal frameshifting", "author_list": "Betts J, Jeffries C, Passchier T, Kung H, Graham S, Abdelhamid M, Howard J, Craggs T, Graham S, Brierley I, Leake M, Quinn S, Hill C", "journal": null, "doi": "10.1101/2025.07.17.665365", "pmid": null, "published_date": "2025 Jul 18" }, "status": "released", "submitted_date": "2025-04-01", "released_date": "2025-07-20" }, "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDWR5.out", "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDWR5.dat", "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWR5_dat_img.png", "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWR5_kratky_img.png", "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDWR5_pofr_img.png", "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWR5_guinier_img.png", "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDWR5.sascif", "experiment": { "instrument": { "detector": { "type": null, "name": "Pilatus 6M", "resolution": null }, "name": "PETRA III", "city": "DESY; Hamburg", "country": "Germany", "beamline_name": "EMBL P12", "beam_geometry": null, "type_of_source": "X-ray synchrotron", "point_source": null, "line_collimation": null, "sample_path_length": null, "line_collimation_slitlength": null, "line_collimation_integrationwidth": null, "xray_energy": null, "beam_profile_ah": null, "beam_profile_al": null }, "sample": { "molecule": [ { "long_name": "Stimulatory element RNA", "short_name": null, "sequence": "CCACAAGGUGCGGUGCUAACUAAAUCCCUAGCACCCC", "organism": "synthetic RNA", "uniprot_code": null, "uniprot_range_first": null, "uniprot_range_last": null, "oligomerization": "monomer", "molecular_type": "RNA", "uniprot_sequence": "", "mw": 11.836, "total_mw": 11.836, "number_molecules": 1, "complex_state": false, "deuteration": null, "molecule_source": "biological", "molecule_description": "Single-stranded RNA" } ], "buffer": { "name": "20 mM HEPES pH 7.4, 400 mM KCl 2% v/v glycerol, 1 mM DTT", "concentration_unit": null, "comment": null, "additive": null, "concentration": null, "pka": null, "ph": null, "deuteration": null }, "purity_method": null, "name": "Stimulatory element RNA", "ext_coefficient": null, "contrast": null, "specific_vol": null, "dry_vol": null, "absorbption": null, "deuteration": null, "mixture": null }, "contributor": [ { "affiliation": [ { "short_name": "EMBL-Hamburg", "address": "Notkestraße 85, Geb. 25A, 22607 Hamburg, Deutschland, Germany", "full_name": "European Molecular Biology Laboratory (EMBL) - Hamburg outstation", "webpage": "http://www.embl-hamburg.de/index.php" } ], "contributor_name": "Cy M", "contributor_surname": "Jeffries", "orcid": null } ], "concentration_method": null, "concentration_unit": null, "date": "2021-04-26", "storage_temperature": 20.0, "cell_temperature": 20.0, "exposure_time": 0.25, "number_of_frames": 57, "wavelength": 0.123983, "sample_detector_distance": 3.0, "concentration_min": null, "concentration_max": 7.08, "sample_volume": 50.0, "flow_rate": 0.35, "s_min": 0.026, "s_max": 7.413, "total_exposure_time": null, "seccolumn": 4 }, "fits": [ { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDWR5_fit1_model1_img.png", "software": "SREFLEX", "pdb_link": [], "model_title": null, "type_of_model": "atomic", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDWR5_fit1_model1.pdb", "model_mw": 11.39, "bead_radius": null, "log": "https://www.sasbdb.org/media/log_files/rc01-6b_m4a00.log", "symmetry": null, "comment": "AlphaFold model with SREFLEX refinement", "user": 9 }, { "model_plot": null, "software": "Other [static image]", "pdb_link": [], "model_title": null, "type_of_model": "other", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDWR5_fit1_model2.png", "model_mw": null, "bead_radius": null, "log": null, "symmetry": null, "comment": null, "user": 9 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDWR5_fit1_fixed_fit_img.png", "software": "CRYSOL", "chi_square_value": 1.11, "p_value": 0.1916, "fit_residual_plot": "SASDWR5_fit1_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDWR5_fit1.fit", "fit_log": null, "software_version": null, "description": "" }, { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDWR5_fit2_model1_img.png", "software": "MONSA", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDWR5_fit2_model1.cif", "model_mw": null, "bead_radius": null, "log": "https://www.sasbdb.org/media/log_files/RNASL4.log", "symmetry": null, "comment": "Single MONSA reconstruction", "user": 9 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDWR5_fit2_fixed_fit_img.png", "software": "MONSA", "chi_square_value": 1.101, "p_value": 0.0808, "fit_residual_plot": "SASDWR5_fit2_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDWR5_fit2.fit", "fit_log": null, "software_version": null, "description": "" }, { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDWR5_fit3_model1_img.png", "software": "Coot", "pdb_link": [], "model_title": null, "type_of_model": "atomic", "software_version": null, "model_data": "https://www.sasbdb.org/media/pdb_file/SASDWR5_fit3_model1.pdb", "model_mw": 11.38, "bead_radius": null, "log": "https://www.sasbdb.org/media/log_files/RNA200.log", "symmetry": null, "comment": null, "user": 9 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDWR5_fit3_fixed_fit_img.png", "software": "CRYSOL", "chi_square_value": 13.95, "p_value": 0.0, "fit_residual_plot": "SASDWR5_fit3_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDWR5_fit3.fit", "fit_log": null, "software_version": null, "description": "" } ], "estimated_volume_method": null, "pddf_software": "ATSAS GNOM", "pddf_software_version": "5.0", "i0_calibration_standard": null, "description": "The models displayed in this entry show: Top: A post normal-mode SREFLEX model obtained using an AlphaFold-predicted structure of the RNA as an initial template, and an alignment of several different SREFLEX outputs. Middle: a MONSA ab initio dummy-atom model reconstruction of the RNA particle. Bottom: A pseudoknot conformation based on the X-ray crystal structure of the RNA in complex with Protein 2A (refer to SASBDB entry SASDWS5; https://www.sasbdb.org/data/SASDWS5). The full entry archive contains the unsubtracted SEC-SAXS 1D-data frames in addition to DAMMIN, MONSA and SREFLEX modelling routines.", "experiment_description": "Synchrotron SAXS data from solutions of stimulatory element RNA in 20 mM HEPES pH 7.4, 400 mM KCl 2% v/v glycerol, 1 mM DTT were collected on the EMBL P12 beam line at PETRA III (DESY; Hamburg, Germany) using a Pilatus 6M detector at a sample-detector distance of 3 m and at a wavelength of λ = 0.123983 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. The SEC parameters were as follows: A 50.00 μl sample at 7.1 mg/ml was injected at a 0.35 ml/min flow rate onto a GE Superdex 75 Increase 5/150 column at 20°C. 57 successive 0.250 second frames were collected through the SEC-elution peak. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.", "tags": [], "intensity_unit": "arbitrary", "experimental_mw": 13.5, "experimental_mw_error": null, "guinier_i0_mw": null, "guinier_i0_mw_error": null, "porod_mw": 10.0, "porod_mw_error": null, "pddf_i0": 7577.0, "pddf_i0_error": null, "guinier_i0": 7530.62, "guinier_i0_error": null, "pddf_rg": 1.989, "pddf_rg_error": null, "guinier_rg": 1.922, "guinier_rg_error": 0.003, "pddf_dmax": 8.0, "pddf_dmax_error": null, "porod_volume": 18.9, "porod_volume_error": null, "estimated_volume": null, "estimated_volume_error": null, "guinier_point_first": 49, "guinier_point_last": 221, "pddf_point_first": null, "pddf_point_last": null, "i0_calibration_standard_data": null, "intensities_log_log_plot": "SASDWR5_datloglog_img.png", "symmetry": null, "last_modified": "2025-07-20T11:29:02.233366+02:00", "bragg_peak": [] }