{
  "code": "SASDUV8",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/A",
  "project": {
    "title": "Selective deuteration of an RNA:RNA complex for structural analysis using small-angle scattering.",
    "publication": {
      "title": "Selective deuteration of an RNA:RNA complex for structural analysis using small-angle scattering.",
      "author_list": "Munsayac A, Leite WC, Hopkins JB, Hall I, O'Neill HM, Keane SC",
      "journal": "Structure",
      "doi": "10.1016/j.str.2025.01.017",
      "pmid": "39933513",
      "published_date": "2025 Feb 6"
    },
    "status": "released",
    "submitted_date": "2024-05-16",
    "released_date": "2025-01-15"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDUV8.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDUV8.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDUV8_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDUV8_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDUV8_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDUV8_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDUV8.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": "Main 1 m x 1 m, Wide angle 1 m x 0.8 m",
        "name": "2–dimensional linear position-sensitive detector",
        "resolution": 256.0
      },
      "name": "High Flux Isotope Reactor",
      "city": "Oak Ridge",
      "country": "United States",
      "beamline_name": "CG-3",
      "beam_geometry": null,
      "type_of_source": "neutron source",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "HIV-1 dimerization initiation site with a CCCCCC apical loop",
          "short_name": "DIS-C",
          "sequence": "GGGCUUGCUGAACCCCCCACGGCAAGACC",
          "organism": null,
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "RNA",
          "uniprot_sequence": "",
          "mw": 9.336,
          "total_mw": 9.336,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": ""
        },
        {
          "long_name": "HIV-1 DIS with a GGGGGG apical loop, UCU bulge, and 16 bp helical extension",
          "short_name": "DIS-Gk",
          "sequence": "GGGUCGCGCUGGCAGAUCUGGGCUUGCUGAAGGGGGGACGGCAAGACCUCUGCCAGCGCGACCC",
          "organism": null,
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "RNA",
          "uniprot_sequence": "",
          "mw": 20.839,
          "total_mw": 20.839,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": ""
        }
      ],
      "buffer": {
        "name": "50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.5,
        "deuteration": null
      },
      "purity_method": null,
      "name": "HIV-1 ²H-DIS-C:¹H-DIS-Gk RNA heterocomplex (DIS-Gk contrast matched in 65% v/v D₂O - SANS data)",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": null,
            "full_name": "University of Michigan",
            "webpage": null
          }
        ],
        "contributor_name": "Aldrex",
        "contributor_surname": "Munsayac",
        "orcid": "https://orcid.org/0000-0001-7268-020X"
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2022-10-05",
    "storage_temperature": 4.0,
    "cell_temperature": 20.0,
    "exposure_time": 37800.0,
    "number_of_frames": 1,
    "wavelength": 0.6,
    "sample_detector_distance": 7.0,
    "concentration_min": null,
    "concentration_max": 4.2,
    "sample_volume": 250.0,
    "flow_rate": 0.6,
    "s_min": 0.099,
    "s_max": 9.254,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDUV8_fit1_model1_img.png",
          "software": "RNAMasonry",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "atomic",
          "software_version": null,
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDUV8_fit1_model1.pdb",
          "model_mw": 8.97,
          "bead_radius": null,
          "log": null,
          "symmetry": null,
          "comment": null,
          "user": 788
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDUV8_fit1_fixed_fit_img.png",
      "software": "CRYSON",
      "chi_square_value": 1.341,
      "p_value": 0.5957,
      "fit_residual_plot": "SASDUV8_fit1_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDUV8_fit1.fit",
      "fit_log": null,
      "software_version": null,
      "description": ""
    }
  ],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": "5.0",
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "SANS data from solutions of the HIV-1 ²H-DIS-C:¹H-DIS-Gk RNA heterocomplex in 50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl, 65% v/v D2O, pH 7.5 were collected on the CG-3 bio-SANS instrument at the High Flux Isotope Reactor, Oak Ridge National Laboratory, (TN, USA) using a 2–dimensional linear position-sensitive detector detector at a sample-detector distance of 7 m and at a wavelength of λ = 0.6 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). One solute concentration of 4.20 mg/ml was measured at 20°C over a period of 37800 seconds. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
  "tags": [],
  "intensity_unit": "1/cm",
  "experimental_mw": 4.5,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": 0.001952,
  "pddf_i0_error": 0.00012,
  "guinier_i0": 0.020754,
  "guinier_i0_error": 0.001,
  "pddf_rg": 1.626,
  "pddf_rg_error": 0.13,
  "guinier_rg": 1.56,
  "guinier_rg_error": 0.135,
  "pddf_dmax": 5.3,
  "pddf_dmax_error": null,
  "porod_volume": null,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 16,
  "guinier_point_last": 37,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDUV8_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2025-02-12T14:50:26.807679+01:00",
  "bragg_peak": []
}