{ "code": "SASDBX3", "status": "Published", "type_of_curve": "Single concentration", "angular_unit": "1/nm", "project": { "title": "Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes.", "publication": { "title": "Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes.", "author_list": "Banerjee A, Herman E, Serif M, Maestre-Reyna M, Hepp S, Pokorny R, Kroth PG, Essen LO, Kottke T", "journal": "Nucleic Acids Res", "doi": "10.1093/nar/gkw420", "pmid": "27179025", "published_date": "2016 Jul 8" }, "status": "released", "submitted_date": "2016-02-14", "released_date": "2016-09-19" }, "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDBX3.out", "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDBX3.dat", "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBX3_dat_img.png", "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBX3_kratky_img.png", "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDBX3_pofr_img.png", "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBX3_guinier_img.png", "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBX3.sascif", "experiment": { "instrument": { "detector": { "type": "Dectris", "name": "Pilatus 1M", "resolution": 172.0 }, "name": "ESRF", "city": "Grenoble", "country": "France", "beamline_name": "BM29", "beam_geometry": "", "type_of_source": "X-ray synchrotron", "point_source": null, "line_collimation": null, "sample_path_length": null, "line_collimation_slitlength": null, "line_collimation_integrationwidth": null, "xray_energy": null, "beam_profile_ah": null, "beam_profile_al": null }, "sample": { "molecule": [ { "long_name": "Aureobox dsDNA", "short_name": null, "sequence": "GAATTGTTGACGTGGAGTTGC\r\nGCAACTCCACGTCAACAATTC", "organism": "synthetic construct", "uniprot_code": null, "uniprot_range_first": null, "uniprot_range_last": null, "oligomerization": "monomer", "molecular_type": "DNA", "uniprot_sequence": null, "mw": 12.993, "total_mw": 12.993, "number_molecules": 1, "complex_state": false, "deuteration": null, "molecule_source": "biological", "molecule_description": null } ], "buffer": { "name": "50 mM Tris 50 mM boric acid 1 mM EDTA", "concentration_unit": "mM", "comment": null, "additive": "50 mM boric acid, 1 mM EDTA", "concentration": 50.0, "pka": null, "ph": 8.0, "deuteration": null }, "purity_method": null, "name": "Aureobox dsDNA", "ext_coefficient": null, "contrast": null, "specific_vol": null, "dry_vol": null, "absorbption": null, "deuteration": null, "mixture": null }, "contributor": [ { "affiliation": [ { "short_name": null, "address": "Marburg, Germany", "full_name": "Philipps-Universität Marburg", "webpage": "" } ], "contributor_name": "Ankan", "contributor_surname": "Banerjee", "orcid": null } ], "concentration_method": null, "concentration_unit": null, "date": "2014-11-06", "storage_temperature": 4.0, "cell_temperature": 4.0, "exposure_time": 20.0, "number_of_frames": 10, "wavelength": 0.93, "sample_detector_distance": 2.43, "concentration_min": null, "concentration_max": 1.25, "sample_volume": null, "flow_rate": null, "s_min": 0.036, "s_max": 4.975, "total_exposure_time": null, "seccolumn": null }, "fits": [ { "models": [ { "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDBX3_fit1_model1_img.png", "software": "DAMFILT", "pdb_link": [], "model_title": null, "type_of_model": "dummy", "software_version": "", "model_data": "https://www.sasbdb.org/media/pdb_file/SASDBX3_fit1_model1.pdb", "model_mw": null, "bead_radius": 2.0, "log": null, "symmetry": "", "comment": "Averaged and filtered/volume corrected model", "user": 72 } ], "fit_unit": "1/A", "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDBX3_fit1_fit_img.png", "software": null, "chi_square_value": 0.677, "p_value": 0.446, "fit_residual_plot": "SASDBX3_fit1_fitresiduals_img.png", "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDBX3_fit1.fir", "fit_log": null, "software_version": null, "description": null } ], "estimated_volume_method": null, "pddf_software": "ATSAS GNOM", "pddf_software_version": null, "i0_calibration_standard": null, "description": null, "experiment_description": "X-ray synchrotron radiation scattering data from solution of Aureo box dsDNA in 0.5X TBE (50 mM Tris pH 8, 50 mM boric acid, 1 mM EDTA) buffer was collected on the BM29 camera on the storage ring ESRF (Grenoble, France) using a 2D Photon counting Pilatus 1M-W pixel detector (s = 4π sin θ/λ, where 2θ is the scattering angle). Ten successive 20 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. Solution scattering data of Aureo box dsDNA was performed at 1.25mg/mL concentration at 4 degrees centigrade. The modelling analysis was performed using the ATSAS package. The displayed model is an averaged and volume corrected dummy atom representation (DAMFILT).", "tags": [], "intensity_unit": null, "experimental_mw": 11.9, "experimental_mw_error": null, "guinier_i0_mw": 9.3, "guinier_i0_mw_error": null, "porod_mw": 11.9, "porod_mw_error": null, "pddf_i0": 22.14, "pddf_i0_error": null, "guinier_i0": 21.45, "guinier_i0_error": null, "pddf_rg": 2.195, "pddf_rg_error": null, "guinier_rg": 2.04, "guinier_rg_error": null, "pddf_dmax": 8.6, "pddf_dmax_error": null, "porod_volume": 17.8, "porod_volume_error": null, "estimated_volume": null, "estimated_volume_error": null, "guinier_point_first": 85, "guinier_point_last": 126, "pddf_point_first": null, "pddf_point_last": null, "i0_calibration_standard_data": null, "intensities_log_log_plot": "SASDBX3_datloglog_img.png", "symmetry": null, "last_modified": "2019-12-06T13:07:15.624532+01:00", "bragg_peak": [] }