← Back to search

11qf

I-PnoMI with solubilizing mutations

Method: X-RAY DIFFRACTION D_max: 118.4 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	11qf
deposition_date	2026-03-10
last_revision	2026-03-25
title	I-PnoMI with solubilizing mutations
keywords	Homing endonuclease, enzyme, DNA, mutation, DNA BINDING PROTEIN; DNA BINDING PROTEIN
method	X-RAY DIFFRACTION

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	33.15 Å
rg_electron	31.80 Å
i0	208547000.00
molecular_weight	97968.0 kDa
excluded_volume	114910 Å³
envelope_volume	146850 Å³
shell_volume	38964 Å³
envelope_diameter	124.7 Å
shell_rg	38.12 Å
envelope_rg	31.77 Å
shape_rg	31.72 Å
total_rg	32.43 Å
total_atoms	6772
n_residues	703
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	118.4 Å
rg_real	33.20 Å
rg_real_error	1.17 Å
i0_real	2.0850e+08
i0_real_error	3.5720e+06
rg_reciprocal	33.18 Å
i0_reciprocal	208500000.0000
total_estimate	0.8553
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	44.4 Å
skewness	0.335
kurtosis	-0.279
angular_range	— – 0.2400 Å⁻¹
current_alpha	0.0000
highest_alpha	33700000.0000
n_real_points	49
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.755; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.877; Smooth: 0.973

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (5)

Entity 1 polymer

description	I-PnoMI
formula_weight	34473.2 kDa
src_method	man
entity_count	2

Polymer

type	polypeptide(L)
strand_id	A,B
atom_count	7273

MYRSTIVNPWVWSGLIDGEGSFSIIISKSKKRKLGWRVELKFQLGLHKKDLNLLELLQQHLGGIGSIHLAKNRDMVNYSIDSIKDLNNLIDYLDKYPLLTQKAADFLLLKKAVELVNNKAHLTLEGLEKIVNIKASMNLGLSDMLISEFPGYVPVERPVINNDNVILNPYWISGFVSAEGNFDVRVPSTNSKLGYRVQLRFRISQHSRDLILMQKIVEYLGCGKIYKYAGKSSISLTIVDFKDITNILVPFFDEYPIIGIKLHDYLDWCKIHSLMLNKSHLTVEGINSIRKIKSGMNTGRNF

Source

organism	Phaeosphaeria nodorum
ncbi_taxonomy_id	13684
host_organism	Escherichia coli

Entity 2 polymer

description	DNA (26-MER)
formula_weight	8045.2 kDa
src_method	syn
entity_count	2

Polymer

type	polydeoxyribonucleotide
strand_id	C,E

GGAAGATCCTCATAACCAAAGGTTGG

Entity 3 polymer

description	DNA (26-MER)
formula_weight	7929.1 kDa
src_method	syn
entity_count	2

Polymer

type	polydeoxyribonucleotide
strand_id	D,F

CCCAACCTTTGGTTATGAGGATCTTC

Entity 4 non-polymer

description	CALCIUM ION
formula_weight	40.1 kDa
src_method	syn
entity_count	4

Entity 5 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	493

▶

6. Citations (1)

▶

length_a	76.945 Å
length_b	168.234 Å
length_c	76.957 Å
angle_alpha	90.00 °
angle_beta	93.65 °
angle_gamma	90.00 °
z_pdb	8

space_group	I 1 2 1
int_tables_number	5
crystal_system	—

resolution	1.870 Å
resolution_low	46.680 Å
r_factor	0.1843
r_work	0.1831
r_free	0.2290

fit	/app/data/saxs_computation/1q/11qf/11qf.fit
pddf	/app/data/pr_computation/1q/11qf/11qf.pr.out
profile	/app/data/saxs_computation/1q/11qf/11qf.dat

I-PnoMI with solubilizing mutations

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

Diffraction

5. Entities & Polymer Info (5)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 polymer

Polymer

Entity 4 non-polymer

Entity 5 water

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)