1qwa
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
1. Protein Identity and Related Structures Protein Identity & Related Structures
No usable UniProt protein identity is available for this entry.
The relationship tables retain this entry's assembly and composition data, but cross-PDB links for the same protein cannot be established reliably without a unified protein identity.
Assembly Composition of the Current Entry
| Assembly | Physical composition | Protein state | 蛋白 / DNA / RNA / 其他Polymer | Data consistency |
|---|---|---|---|---|
| 1 | Nucleic acid only | No protein | 0 / 0 / 1 / 0 | Consistent with all polymers |
The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.
2. Structure Basics 2. Structure Basics
| Entry ID entry_id | 1qwa |
| Deposition date deposition_date | 2003-09-01 |
| Structure title title | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. |
| Keywords keywords | tetraloop, UNCG, UUCG, YNMG, bulged nucleotide, hairpin, A-form helix, RNA; RNA |
| Experimental Method method | SOLUTION NMR |
3. Official assembly/model SAXS Official SAXS Profiles
This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.
1qwa__assembly_1__model_6
Assembly 1 · Model 6 · CRYSOL 4.1.3-1-20251215 (887e7ef)
1qwa__assembly_1__model_6 | I(q)
1qwa__assembly_1__model_6 | P(r) · Pending
| Rg(Guinier) | 14.40 Å |
| Rg (electron density) | 14.08 Å |
| Total Rg | 14.72 Å |
| Atom count | 670 |
| Residues | 21 |
| Excluded volume | 6283 ų |
| Maximum q | 0.500 Å⁻¹ |
| Assembly | Model | Structure unit | Oligomeric description | Status | CRYSOL | Actions |
|---|---|---|---|---|---|---|
| 1 | 1 | 1qwa__assembly_1__model_1 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 2 | 1qwa__assembly_1__model_2 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 3 | 1qwa__assembly_1__model_3 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 4 | 1qwa__assembly_1__model_4 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 5 | 1qwa__assembly_1__model_5 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 6 | 1qwa__assembly_1__model_6 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 7 | 1qwa__assembly_1__model_7 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 8 | 1qwa__assembly_1__model_8 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 9 | 1qwa__assembly_1__model_9 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 10 | 1qwa__assembly_1__model_10 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 11 | 1qwa__assembly_1__model_11 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 12 | 1qwa__assembly_1__model_12 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 13 | 1qwa__assembly_1__model_13 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 14 | 1qwa__assembly_1__model_14 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 15 | 1qwa__assembly_1__model_15 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 16 | 1qwa__assembly_1__model_16 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |
| 1 | 17 | 1qwa__assembly_1__model_17 |
monomeric (1) | Success | 4.1.3-1-20251215 (887e7ef) | View Download |