1qwb

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Method: SOLUTION NMR
▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

No usable UniProt protein identity is available for this entry.

The relationship tables retain this entry's assembly and composition data, but cross-PDB links for the same protein cannot be established reliably without a unified protein identity.

Assembly Composition of the Current Entry

Assembly Physical composition Protein state 蛋白 / DNA / RNA / 其他Polymer Data consistency
1 Nucleic acid only No protein 0 / 0 / 1 / 0 Consistent with all polymers

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id1qwb
Deposition date deposition_date2003-09-01
Structure title titleNMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
Keywords keywordsA-form helix, loop E motif, S-turn, disordered hairpin loop, RNA; RNA
Experimental Method methodSOLUTION NMR
▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1qwb__assembly_1__model_8

Assembly 1 · Model 8 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1qwb__assembly_1__model_8 | I(q)

10-2 10-1 105 106 q (1/Angstrom) I(q)
100 plotted points; both axes use logarithmic scales.

1qwb__assembly_1__model_8 | P(r) · Pending

The new assembly/model P(r) has not been calculated yet This placeholder does not display legacy data r (Angstrom) P(r)
P(r) will be calculated and displayed separately for the same assembly/model.
Rg(Guinier)16.14 Å
Rg (electron density)16.09 Å
Total Rg16.63 Å
Atom count838
Residues26
Excluded volume7827 ų
Maximum q0.500 Å⁻¹
Assembly Model Structure unit Oligomeric description Status CRYSOL Actions
1 1 1qwb__assembly_1__model_1 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 2 1qwb__assembly_1__model_2 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 3 1qwb__assembly_1__model_3 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 4 1qwb__assembly_1__model_4 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 5 1qwb__assembly_1__model_5 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 6 1qwb__assembly_1__model_6 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 7 1qwb__assembly_1__model_7 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 8 1qwb__assembly_1__model_8 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 9 1qwb__assembly_1__model_9 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 10 1qwb__assembly_1__model_10 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 11 1qwb__assembly_1__model_11 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 12 1qwb__assembly_1__model_12 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 13 1qwb__assembly_1__model_13 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 14 1qwb__assembly_1__model_14 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 15 1qwb__assembly_1__model_15 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 16 1qwb__assembly_1__model_16 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
1 17 1qwb__assembly_1__model_17 monomeric (1) Success 4.1.3-1-20251215 (887e7ef) View Download
▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (1)

▶

7. Citations (1)