SAXSdb — 1wz2

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucyl-tRNA synthetase

Pyrococcus horikoshii

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA × 1	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYL_PYRHO
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–967； UniProt 1–967 Author chain B； PDBConstruct 1–967； UniProt 1–967

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1wz2
Deposition date deposition_date	2005-02-21
Structure title title	The crystal structure of Leucyl-tRNA synthetase and tRNA(leucine) complex
Keywords keywords	Ligase, tRNA, RIKEN Structural Genomics/Proteomics Initiative, RSGI, Structural Genomics, Ligase-RNA COMPLEX; Ligase/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1wz2__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1wz2__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1wz2__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	36.65 Å
Rg (electron density)	37.37 Å
Total Rg	37.70 Å
Atom count	9789
Residues	1036
Excluded volume	168610 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1wz2__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`1wz2__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Description description	tRNA
Molecular weight formula_weight	28376.9 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,D
Atom count atom_count	19578

GCGGGGGUUGCCGAGCCUGGUCAAAGGCGGGGGACUCAAGAUCCCCUCCCGUAGGGGUUCCGGGGUUCGAAUCCCCGCCCCCGCACCA

Entity 2 Entity 2 polymer

Description description	Leucyl-tRNA synthetase
Molecular weight formula_weight	114122.4 kDa
EC 编号 ec_number	6.1.1.4
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MAELNFKAIEEKWQKRWLEAKIFEPNIRDKPKEKKFYITVAFPYLSGHLHVGHARTYTIPDVIARFKRMQGYNVLFPMAWHITGSPIVGIAERIKNRDPKTIWIYRDVYKVPEEILWTFEDPINIVKYFMKAAKETFIRAGFSVDWSREFYTTSLFPPFSKFIEWQFWKLKEKGYIVKGAHRVRWDPVVGTPLGDHDLMEGEDVPILDYIIIKFELRENGEVIYLPAATLRPETVYGVTNMWVNPNATYVKAKVRRKDKEETWIVSKEAAYKLSFQDREIEVIEEFKGEKLIGKYVRNPVSGDEVIILPAEFVDPDNATGVVMSVPAHAPFDHVALEDLKRETEILEKYDIDPRIVENITYISLIKLEGYGDFPAVEEVNKLGIKSQKDKEKLEQATKTIYKAEYHKGIFKVPPYEGKPVQEVKEAIAKEMLEKGIAEIMYEFAEKNVISRFGNRAVIKIIHDQWFIDYGNPEWKEKARKALERMKILPETRRAQFEAIIDWLDKKACARKIGLGTPLPWDPEWVIESLSDSTIYMAYYTISRHINKLRQEGKLDPEKLTPEFFDYIFLEEFSEDKEKELEKKTGIPAEIIHEMKEEFEYWYPLDWRCSGKDLIPNHLTFFIFNHVAIFREEHWPKGIAVNGFGTLEGQKMSKSKGNVLNFIDAIEENGADVVRLYIMSLAEHDSDFDWRRKEVGKLRKQIERFYELISQFAEYEVKGNVELKDIDRWMLHRLNKAIKETTNALEEFRTRTAVQWAFYSIMNDLRWYLRRTEGRDDEAKRYVLRTLADVWVRLMAPFTPHICEELWEKLGGEGFVSLAKWPEPVEEWWNETIEAEEEFIRSVMEDIKEIIEVAKIENAKRAYIYTAEDWKWKVAEVVSEKRDFKSSMEELMKDSEIRKHGKEVAKIVQKLIKERTFDVKRINEEKALREAKEFMEKELGIEIIINPTEDKGGKKKQAMPLKPAIFIE

Source Source

Source organism organism	Pyrococcus horikoshii
NCBI taxonomy ID ncbi_taxonomy_id	70601
Host organism host_organism	Escherichia coli BL21(DE3)

▼

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

Domain ID domain_id	1wz2A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1wz2A02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	740 — Isoleucyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Valyl/Leucyl/Isoleucyl-tRNA synthetase, editing domain

Domain ID domain_id	1wz2A03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

Domain ID domain_id	1wz2A04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	2320 — hypothetical protein PF0899 fold
Homologous superfamily homologous superfamily	20 — Class I aminoacyl-tRNA synthetases (RS)

Domain ID domain_id	1wz2A05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	720 — leucyl-tRNA synthetase

Domain ID domain_id	1wz2B01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1wz2B02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	740 — Isoleucyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Valyl/Leucyl/Isoleucyl-tRNA synthetase, editing domain

Domain ID domain_id	1wz2B03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

Domain ID domain_id	1wz2B04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	2320 — hypothetical protein PF0899 fold
Homologous superfamily homologous superfamily	20 — Class I aminoacyl-tRNA synthetases (RS)

Domain ID domain_id	1wz2B05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	720 — leucyl-tRNA synthetase

▶

Unit-cell length a length_a	120.546 Å
Unit-cell length b length_b	231.127 Å
Unit-cell length c length_c	118.181 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	3.210 Å
Low-resolution limit resolution_low	14.990 Å
R factor r_factor	0.2410
R_work r_work	0.2410
R_free r_free	0.3050

The crystal structure of Leucyl-tRNA synthetase and tRNA(leucine) complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1wz2__assembly_1__model_1

1wz2__assembly_1__model_1 | I(q)

1wz2__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)

The crystal structure of Leucyl-tRNA synthetase and tRNA(leucine) complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1wz2__assembly_1__model_1

1wz2__assembly_1__model_1 | I(q)

1wz2__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)