1z9c

Crystal structure of OhrR bound to the ohrA promoter: Structure of MarR family protein with operator DNA

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Organic hydroperoxide resistance transcriptional regulator

Bacillus subtilis

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA (29-MER) × 1 DNA (29-MER) × 1 water × 4	Consistent with all polymers
2	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA (29-MER) × 1 DNA (29-MER) × 1 water × 4	Consistent with all polymers
3	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA (29-MER) × 1 DNA (29-MER) × 1 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	OHRR_BACSU
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–147； UniProt 1–147 Author chain B； PDBConstruct 1–147； UniProt 1–147 Author chain C； PDBConstruct 1–147； UniProt 1–147 Author chain D； PDBConstruct 1–147； UniProt 1–147 Author chain E； PDBConstruct 1–147； UniProt 1–147 Author chain F； PDBConstruct 1–147； UniProt 1–147

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1z9c
Deposition date deposition_date	2005-04-01
Structure title title	Crystal structure of OhrR bound to the ohrA promoter: Structure of MarR family protein with operator DNA
Keywords keywords	OhrR, MarR family protein, bacterial transcription factor, Winged HTH protein, TRANSCRIPTION-DNA COMPLEX; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1z9c__assembly_3__model_1

Assembly 3 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1z9c__assembly_3__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1z9c__assembly_3__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	25.50 Å
Rg (electron density)	24.06 Å
Total Rg	24.78 Å
Atom count	3324
Residues	332
Excluded volume	56437 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1z9c__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`1z9c__assembly_2__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`1z9c__assembly_3__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	DNA (29-MER)
Molecular weight formula_weight	8895.8 kDa
Source method src_method	syn
Copy count entity_count	3

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G,I,K
Atom count atom_count	10073

TACAATTTAATTGTATACAATTTAATTGT

Entity 2 Entity 2 polymer

Description description	DNA (29-MER)
Molecular weight formula_weight	8913.8 kDa
Source method src_method	syn
Copy count entity_count	3

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H,J,L

TACAATTAAATTGTATACAATTAAATTGT

Entity 3 Entity 3 polymer

Description description	Organic hydroperoxide resistance transcriptional regulator
Molecular weight formula_weight	17009.7 kDa
Mutation mutation	C15S
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F

MENKFDHMKLENQLSFLLYASSREMTKQYKPLLDKLNITYPQYLALLLLWEHETLTVKKMGEQLYLDSGTLTPMLKRMEQQGLITRKRSEEDERSVLISLTEDGALLKEKAVDIPGTILGLSKQSGEDLKQLKSALYTLLETLHQKN

Source Source

Source organism organism	Bacillus subtilis
NCBI taxonomy ID ncbi_taxonomy_id	1423
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	174

▼

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

Domain ID domain_id	d1z9ca_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.5 — 'Winged helix' DNA-binding domain
Family Family family	a.4.5.28 — MarR-like transcriptional regulators

Domain ID domain_id	d1z9cb_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.5 — 'Winged helix' DNA-binding domain
Family Family family	a.4.5.28 — MarR-like transcriptional regulators

Domain ID domain_id	d1z9cc_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.5 — 'Winged helix' DNA-binding domain
Family Family family	a.4.5.28 — MarR-like transcriptional regulators

Domain ID domain_id	d1z9cd_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.5 — 'Winged helix' DNA-binding domain
Family Family family	a.4.5.28 — MarR-like transcriptional regulators

Domain ID domain_id	d1z9ce_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.5 — 'Winged helix' DNA-binding domain
Family Family family	a.4.5.28 — MarR-like transcriptional regulators

Domain ID domain_id	d1z9cf_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.5 — 'Winged helix' DNA-binding domain
Family Family family	a.4.5.28 — MarR-like transcriptional regulators

CATH v4.4 (6 domains)

Domain ID domain_id	1z9cA00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1z9cB00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1z9cC00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1z9cD00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1z9cE00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1z9cF00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

▶

Unit-cell length a length_a	81.899 Å
Unit-cell length b length_b	80.960 Å
Unit-cell length c length_c	109.340 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	100.20 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.640 Å
Low-resolution limit resolution_low	59.650 Å
R factor r_factor	0.2160
R_work r_work	0.2160
R_free r_free	0.2770

Crystal structure of OhrR bound to the ohrA promoter: Structure of MarR family protein with operator DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Organic hydroperoxide resistance transcriptional regulator

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1z9c__assembly_3__model_1

1z9c__assembly_3__model_1 | I(q)

1z9c__assembly_3__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

CATH v4.4 (6 domains)

7. Citations (1)

Crystal structure of OhrR bound to the ohrA promoter: Structure of MarR family protein with operator DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Organic hydroperoxide resistance transcriptional regulator

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1z9c__assembly_3__model_1

1z9c__assembly_3__model_1 | I(q)

1z9c__assembly_3__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

CATH v4.4 (6 domains)

7. Citations (1)