SAXSdb — 2dvi

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-adding enzyme

Archaeoglobus fulgidus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA (34-MER) × 1 SULFATE ION × 1 MAGNESIUM ION × 1 CYTIDINE-5'-TRIPHOSPHATE × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	CCA_ARCFU
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–437； UniProt 1–437

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2dvi
Deposition date deposition_date	2006-07-31
Structure title title	Complex structure of CCA-adding enzyme, mini-DCC and CTP
Keywords keywords	protein-rna complex, TRANSFERASE-RNA COMPLEX; TRANSFERASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2dvi__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2dvi__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2dvi__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	27.71 Å
Rg (electron density)	27.54 Å
Total Rg	28.10 Å
Atom count	4338
Residues	465
Excluded volume	74679 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2dvi__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	tRNA (34-MER)
Molecular weight formula_weight	10904.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	4512

GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCACC

Entity 2 Entity 2 polymer

Description description	CCA-adding enzyme
Molecular weight formula_weight	51469.1 kDa
EC 编号 ec_number	2.7.7.25, 2.7.7.21
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MKVEEILEKALELVIPDEEEVRKGREAEEELRRRLDELGVEYVFVGSYARNTWLKGSLEIDVFLLFPEEFSKEELRERGLEIGKAVLDSYEIRYAEHPYVHGVVKGVEVDVVPCYKLKEPKNIKSAVDRTPFHHKWLEGRIKGKENEVRLLKGFLKANGIYGAEYKVRGFSGYLCELLIVFYGSFLETVKNARRWTRRTVIDVAKGEVRKGEEFFVVDPVDEKRNVAANLSLDNLARFVHLCREFMEAPSLGFFKPKHPLEIEPERLRKIVEERGTAVFAVKFRKPDIVDDNLYPQLERASRKIFEFLERENFMPLRSAFKASEEFCYLLFECQIKEISRVFRRMGPQFEDERNVKKFLSRNRAFRPFIENGRWWAFEMRKFTTPEEGVRSYASTHWHTLGKNVGESIREYFEIISGEKLFKEPVTAELCEMMGVKD

Source Source

Source organism organism	Archaeoglobus fulgidus
NCBI taxonomy ID ncbi_taxonomy_id	2234
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	CYTIDINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	483.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	174

▼

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d2dvia1
Class class	a — All alpha proteins
Fold Fold fold	a.160 — PAP/OAS1 substrate-binding domain
Superfamily Superfamily superfamily	a.160.1 — PAP/OAS1 substrate-binding domain
Family Family family	a.160.1.3 — Archaeal tRNA CCA-adding enzyme substrate-binding domain

Domain ID domain_id	d2dvia2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.218 — Nucleotidyltransferase
Superfamily Superfamily superfamily	d.218.1 — Nucleotidyltransferase
Family Family family	d.218.1.7 — Archaeal tRNA CCA-adding enzyme catalytic domain

Domain ID domain_id	d2dvia3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.58 — Ferredoxin-like
Superfamily Superfamily superfamily	d.58.16 — PAP/Archaeal CCA-adding enzyme, C-terminal domain
Family Family family	d.58.16.2 — Archaeal tRNA CCA-adding enzyme

CATH v4.4 (4 domains)

Domain ID domain_id	2dviA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	30 — CCA tRNA nucleotidyltransferase, domain 2

Domain ID domain_id	2dviA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	10 — Beta Polymerase, domain 2

Domain ID domain_id	2dviA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	590 — Poly(A) polymerase predicted RNA binding domain

Domain ID domain_id	2dviA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	1550 — Archaeal tRNA CCA-adding enzyme catalytic domain

▶

Unit-cell length a length_a	58.004 Å
Unit-cell length b length_b	58.004 Å
Unit-cell length c length_c	431.498 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 43 21 2
Space-group number int_tables_number	96
Crystal system crystal_system	—

Resolution resolution	2.610 Å
Low-resolution limit resolution_low	9.990 Å
R factor r_factor	0.2070
R_work r_work	0.2070
R_free r_free	0.2520

Complex structure of CCA-adding enzyme, mini-DCC and CTP

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-adding enzyme

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2dvi__assembly_1__model_1

2dvi__assembly_1__model_1 | I(q)

2dvi__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

CATH v4.4 (4 domains)

7. Citations (1)

Complex structure of CCA-adding enzyme, mini-DCC and CTP

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-adding enzyme

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2dvi__assembly_1__model_1

2dvi__assembly_1__model_1 | I(q)

2dvi__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

CATH v4.4 (4 domains)

7. Citations (1)