SAXSdb — 2qoj

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

LAGLIDADG endonuclease

Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 2	I-AniI DNA target seq1 × 1 I-AniI DNA target seq2 × 1 MAGNESIUM ION × 3 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	H9D0N7_EMENI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain Z； PDBConstruct 1–254； UniProt 23–276

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2qoj
Deposition date deposition_date	2007-07-20
Structure title title	Coevolution of a homing endonuclease and its host target sequence
Keywords keywords	;LAGLIDADG homing endonuclease, I-AniI, Hydrolase, Intron homing, Mitochondrion, mRNA processing, mRNA splicing, hydrolase-DNA COMPLEX ;; hydrolase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2qoj__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2qoj__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2qoj__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	26.10 Å
Rg (electron density)	24.48 Å
Total Rg	25.26 Å
Atom count	3298
Residues	311
Excluded volume	55618 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2qoj__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	LAGLIDADG endonuclease
Molecular weight formula_weight	29615.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	Z
Atom count atom_count	3344

GSDLTYAYLVGLFEGDGYFSITKKGKYLTYELGIELSIKDVQLIYKIKKILGIGIVSFRKRNEIEMVALRIRDKNHLKSFILPIFEKYPMFSNKQYDYLRFRNALLSGIISLEDLPDYTRSDEPLNSIESIINTSYFSAWLVGFIEAEGCFSVYKLNKDDDYLIASFDIAQRDGDILISAIRKYLSFTTKVYLDKTNCSKLKVTSVRSVENIIKFLQNAPVKLLGNKKLQYLLWLKQLRKISRYSEKIKIPSNY

Source Source

Source organism organism	Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Common name common_name	Aspergillus nidulans
NCBI taxonomy ID ncbi_taxonomy_id	227321
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	I-AniI DNA target seq1
Molecular weight formula_weight	9609.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X

GCGCGCTGAGGAGGTTTCTCTGTAAAGCGCA

Entity 3 Entity 3 polymer

Description description	I-AniI DNA target seq2
Molecular weight formula_weight	9458.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Y

GCGCTTTACAGAGAAACCTCCTCAGCGCGCT

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	46

▼

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d2qojz1
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d2qojz2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d2qojz3
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

CATH v4.4 (2 domains)

Domain ID domain_id	2qojZ01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

Domain ID domain_id	2qojZ02
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

▶

Unit-cell length a length_a	60.353 Å
Unit-cell length b length_b	72.701 Å
Unit-cell length c length_c	61.100 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	103.88 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.400 Å
Low-resolution limit resolution_low	29.300 Å
R factor r_factor	0.2190
R_work r_work	0.2160
R_free r_free	0.2760

Coevolution of a homing endonuclease and its host target sequence

1. Protein Identity and Related Structures Protein Identity & Related Structures

LAGLIDADG endonuclease

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2qoj__assembly_1__model_1

2qoj__assembly_1__model_1 | I(q)

2qoj__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (3 domains)

CATH v4.4 (2 domains)

7. Citations (1)

Coevolution of a homing endonuclease and its host target sequence

1. Protein Identity and Related Structures Protein Identity & Related Structures

LAGLIDADG endonuclease

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2qoj__assembly_1__model_1

2qoj__assembly_1__model_1 | I(q)

2qoj__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (3 domains)

CATH v4.4 (2 domains)

7. Citations (1)