SAXSdb — 2zue

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Arginyl-tRNA synthetase

Pyrococcus horikoshii

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA-Arg × 1 PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 1 MAGNESIUM ION × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYR_PYRHO
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–629； UniProt 1–629

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2zue
Deposition date deposition_date	2008-10-16
Structure title title	Crystal structure of Pyrococcus horikoshii arginyl-tRNA synthetase complexed with tRNA(Arg) and an ATP analog (ANP)
Keywords keywords	;RRS/TRNA(Arg)/ATP, Aminoacyl-tRNA synthetase, ATP-binding, Cytoplasm, Ligase, Nucleotide-binding, Protein biosynthesis, Ligase-RNA COMPLEX ;; Ligase/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2zue__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2zue__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2zue__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	29.80 Å
Rg (electron density)	29.43 Å
Total Rg	30.08 Å
Atom count	6735
Residues	703
Excluded volume	114790 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2zue__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Arginyl-tRNA synthetase
Molecular weight formula_weight	72444.6 kDa
EC 编号 ec_number	6.1.1.19
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	7140

MLMEIRESVKERIEEIIKEIAPQWEGEIELKETPDPKLGDFGTPIAFKLAKLLKRPPIEIAEKIVEKLKLNLPEGIKDVKAVNGYINVFIDYPHFARILINDILAKGDRFGSSEIGKGKKVIVEHTSVNPTKPLHMGHARNAILGDVMARILRFLGYEVEVQNYIDDLGIQFAQVYWGYLRLKEEFERIMNELRERGLKDNPIDHALGLLYVEVNRRLEDNPELENEIRDIMKKLESGELYGRKLAEEVVRAQMVTTYKLGVKYDLLVWESDIVRRKLFEIALELLSKNENFYIPSDGKYRGAFVMDLRKLFPDMKNPILVLRRSDGTATYTGKDIAYHLWKFGKIDVDLLYKEWDSTTWTTAPDGKSMPNKFGNANIVINVIGAEQKHPQLAIKYALQLLGFEDAAANLYHLAYEHVERPEGKFSGRKGTWVGFTVDEVIQEAVKRARELIEEKNPALSDEEKAEVAEKVGIGAIRYNLIKYSPDKKIIFRWEDVLNFEGESAPYIQYAHARCSSILRKAEEEGIKVDPETLFKNADFTKLSERERELVIMLSKFPRIVEQAGKDVKPHLIAWFANELASLFNKFYMDHPVLKAEEGVREARLLLVMAVEQVLKNALYLMGIEAPERM

Source Source

Source organism organism	Pyrococcus horikoshii
NCBI taxonomy ID ncbi_taxonomy_id	53953
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	tRNA-Arg
Molecular weight formula_weight	25161.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GGACCGGUAGCCUAGCCAGGACAGGGCGGCGGCCUCCUAAGCCGCAGGUCCGGGGUUCAAAUCCCCGCCGGUCCGCCA

Entity 3 Entity 3 non-polymer

Description description	PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER
Molecular weight formula_weight	506.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	362

▼

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

Domain ID domain_id	2zueA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	70 — Arginyl tRNA synthetase N-terminal domain

Domain ID domain_id	2zueA02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2zueA03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

▶

Unit-cell length a length_a	76.270 Å
Unit-cell length b length_b	60.000 Å
Unit-cell length c length_c	110.660 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	106.94 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.000 Å
Low-resolution limit resolution_low	39.690 Å
R factor r_factor	0.2190
R_work r_work	0.2130
R_free r_free	0.2530

Crystal structure of Pyrococcus horikoshii arginyl-tRNA synthetase complexed with tRNA(Arg) and an ATP analog (ANP)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Arginyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2zue__assembly_1__model_1

2zue__assembly_1__model_1 | I(q)

2zue__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

7. Citations (1)

Crystal structure of Pyrococcus horikoshii arginyl-tRNA synthetase complexed with tRNA(Arg) and an ATP analog (ANP)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Arginyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2zue__assembly_1__model_1

2zue__assembly_1__model_1 | I(q)

2zue__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

7. Citations (1)