SAXSdb — 3al0

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutamyl-tRNA(Gln) amidotransferase subunit A

Thermotoga maritima

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 3 RNA 1	Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B × 1 （Q9X100） Glutamyl-tRNA(Gln) amidotransferase subunit C,Linker,Glutamate--tRNA ligase 2 × 1 （Q9WY94,Q9X2I8） tRNAGln × 1 ZINC ION × 1 O5'-(L-GLUTAMYL-SULFAMOYL)-ADENOSINE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GATA_THEMA
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–475； UniProt 1–475

Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B

Thermotoga maritima

UniProt Q9X100

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 3 RNA 1	Glutamyl-tRNA(Gln) amidotransferase subunit A × 1 （Q9X0Z9） Glutamyl-tRNA(Gln) amidotransferase subunit C,Linker,Glutamate--tRNA ligase 2 × 1 （Q9WY94,Q9X2I8） tRNAGln × 1 ZINC ION × 1 O5'-(L-GLUTAMYL-SULFAMOYL)-ADENOSINE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GATB_THEMA
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–482； UniProt 1–482

Glutamyl-tRNA(Gln) amidotransferase subunit C,Linker,Glutamate--tRNA ligase 2

Thermotoga maritima

UniProt Q9WY94

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 3 RNA 1	Glutamyl-tRNA(Gln) amidotransferase subunit A × 1 （Q9X0Z9） Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B × 1 （Q9X100） tRNAGln × 1 ZINC ION × 1 O5'-(L-GLUTAMYL-SULFAMOYL)-ADENOSINE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GATC_THEMA
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 3–97； UniProt 2–96

Glutamyl-tRNA(Gln) amidotransferase subunit C,Linker,Glutamate--tRNA ligase 2

Thermotoga maritima

UniProt Q9X2I8

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 3 RNA 1	Glutamyl-tRNA(Gln) amidotransferase subunit A × 1 （Q9X0Z9） Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B × 1 （Q9X100） tRNAGln × 1 ZINC ION × 1 O5'-(L-GLUTAMYL-SULFAMOYL)-ADENOSINE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYE2_THEMA
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 106–592； UniProt 1–487

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3al0
Deposition date deposition_date	2010-07-19
Structure title title	Crystal structure of the glutamine transamidosome from Thermotoga maritima in the glutamylation state.
Keywords keywords	Protein-rna complex, LIGASE-RNA complex; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3al0__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3al0__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3al0__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	47.77 Å
Rg (electron density)	49.20 Å
Total Rg	49.12 Å
Atom count	13869
Residues	1592
Excluded volume	242100 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3al0__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Glutamyl-tRNA(Gln) amidotransferase subunit A
Molecular weight formula_weight	52594.4 kDa
EC 编号 ec_number	6.3.5.7
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	13869

MIDLDFRKLTIEECLKLSEEEREKLPQLSLETIKRLDPHVKAFISVRENVSVEKKGKFWGIPVAIKDNILTLGMRTTCASRILENYESVFDATVVKKMKEAGFVVVGKANLDEFAMGSSTERSAFFPTRNPWDLERVPGGSSGGSAAAVSAGMVVAALGSDTGGSVRQPASLCGVVGYKPTYGLVSRYGLVAFASSLDQIGPITKTVRDAAILMEIISGRDENDATTVNRKVDFLSEIEEGVSGMKFAVPEEIYEHDIEEGVSERFEEALKLLERLGAKVERVKIPHIKYSVATYYVIAPAEASSNLARFDGVKYGLRIKEKGLREMYMKTRNVGFGEEVRRRIMIGTFTLSAAYYEAYFNKAMKVRRKISDELNEVLSQYDAILTPTSPVTAFKIGEIKDPLTYYLMDIFTIPANLAGLPAISVPFGFSNNLPVGVQVIGRRFADGKVFRIARAIEKNSPYNENGMFPLPEVKA

Source Source

Source organism organism	Thermotoga maritima
NCBI taxonomy ID ncbi_taxonomy_id	243274
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B
Molecular weight formula_weight	55514.5 kDa
EC 编号 ec_number	6.3.5.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MRYRPVIGLEIHVQLSTKTKAFCSCPADVFELPPNTAICPVCTGQPGALPVPNEEMIRFAVKTALALNCKIHKYSRFDRKNYFYPDLPKGYQISQYFYPIATEGFLEIDGDEGRKKVRIRRLHLEEDAGKLVHEGDSITRASYSLVDMNRCGVPLIEIVTEPDISSPREARVFMEKLRSIVRYLGVSTGDMEKGALRCDANISVVDTETGRQSNRVEVKNMNSFRFVERALEYEFERIVKAMERGEDVERETRGWDMATKITVSMRGKEEESDYRYFPEPDIPPVVLSDEYLEEVKKELPELPDEKAERFMREYGLPEYDAKVLTSSKELAEFFEECVKVVNRPKDLSNWIMTEVLRELNERNIEITESKLTPQHFADLFKLMDEGKISIKIAKEIFPEVFETGKMPSQIVEEKGLTQINDEKLIEELVKKAMEQNPKAVQDYKSGKKKAAGFFVGYVMRETKGKANPELTNRIIQKLLEGE

Source Source

Source organism organism	Thermotoga maritima
NCBI taxonomy ID ncbi_taxonomy_id	243274
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	Glutamyl-tRNA(Gln) amidotransferase subunit C,Linker,Glutamate--tRNA ligase 2
Molecular weight formula_weight	69411.1 kDa
EC 编号 ec_number	6.3.5.-,6.1.1.17
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MGIKVTKDLVLHLENLARLELSEDQRESLMKDFQEILDYVELLNEVDVEGVEPMYTPVEDSAKLRKGDPRFFEMRDLIKKNFPEEKDGHIKVPGIHRGSGSGSGSMFITGAFFDILEVGPKKIRRCFELVRVRFAPSPTGHLHVGGARTALFNWMFARKEGGKFILRIEDTDTERSSREYEQQILESLRWCGLDWDEGPDIGGDFGPYRQSERLEIYREYAEKLVEDKRAYYVVYDKEDPSKELFTTYEYPHEYKEKGHPVTIKFKVLPGKTSFEDLLKGYMEFDNSTLEDFIIMKSNGFPTYNFAVVVDDHLMRISHVFRGEDHLSNTPKQLMIYEAFGWEAPVFMHIPLILGSDRTPLSKRHGATSVEHFRREGILSRALMNYLALLGWRVEGDEIFTIEEKLQSFDPKDISNKGVIFDYQKLEWVNGKHMRRIDLEDLKREFIEWAKYAGKEIPSVDERYFSETLRICREKVNTLSQLYDIMYPFMNDDYEYEKDYVEKFLKREEAERVLEEAKKAFKDLNSWNMEEIEKTLRDLSEKGLASKKVVFQLIRGAVTGKLVTPGLFETIEVLGKERTLKRLERTLQFLKKT

Source Source

Source organism organism	Thermotoga maritima
NCBI taxonomy ID ncbi_taxonomy_id	243274
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	tRNAGln
Molecular weight formula_weight	23858.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	E

UGGGAGGUCGUCUAACGGUAGGACGGCGGACUCUGGAUCCGCUGGUGGAGGUUCGAGUCCUCCCCUCCCAGCCA

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	O5'-(L-GLUTAMYL-SULFAMOYL)-ADENOSINE
Molecular weight formula_weight	475.4 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

Domain ID domain_id	3al0A00
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	1300 — Amidase signature (AS) enzymes
Homologous superfamily homologous superfamily	10 — Amidase signature (AS) domain

Domain ID domain_id	3al0B03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	410 —

Domain ID domain_id	3al0C02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	3al0C03
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	800 — Glutamyl-tRNA Synthetase; domain 3
Homologous superfamily homologous superfamily	10 — Glutamyl-tRNA Synthetase; Domain 3

Domain ID domain_id	3al0C04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1160 — Glutamyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Glutamyl-trna Synthetase; Domain 2

Domain ID domain_id	3al0C05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	8 — Helicase, Ruva Protein; domain 3
Homologous superfamily homologous superfamily	70 — Glutamate-tRNA synthetase, class I, anticodon-binding domain 1

Domain ID domain_id	3al0C06
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	350 —

▶

Unit-cell length a length_a	76.954 Å
Unit-cell length b length_b	125.661 Å
Unit-cell length c length_c	313.386 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 2 2 21
Space-group number int_tables_number	17
Crystal system crystal_system	—

Resolution resolution	3.368 Å
Low-resolution limit resolution_low	48.669 Å
R factor r_factor	0.1989
R_work r_work	0.1952
R_free r_free	0.2691

Crystal structure of the glutamine transamidosome from Thermotoga maritima in the glutamylation state.

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutamyl-tRNA(Gln) amidotransferase subunit A

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Glutamyl-tRNA(Gln) amidotransferase subunit C,Linker,Glutamate--tRNA ligase 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Glutamyl-tRNA(Gln) amidotransferase subunit C,Linker,Glutamate--tRNA ligase 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3al0__assembly_1__model_1

3al0__assembly_1__model_1 | I(q)

3al0__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

7. Citations (1)