SAXSdb — 3auo

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase beta family (X family)

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 1	1-nt gapped DNA × 1 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 MAGNESIUM ION × 2 ZINC ION × 1 water × 2	Consistent with all polymers
2	Protein–DNA	Monomer	Protein 1 DNA 1	1-nt gapped DNA × 1 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 MAGNESIUM ION × 2 ZINC ION × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q5SJ64_THET8
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–575； UniProt 1–575 Author chain B； PDBConstruct 1–575； UniProt 1–575

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3auo
Deposition date deposition_date	2011-02-11
Structure title title	DNA polymerase X from Thermus thermophilus HB8 ternary complex with 1-nt gapped DNA and ddGTP
Keywords keywords	;RSGI, Structural Genomics, RIKEN Structural Genomics/Proteomics Initiative, POLXc domain, PHP domain, DNA polymerase, dRP lyase, AP endonuclease, 3'-5' exonuclease, DNA repair, DNA binding, nucleotide binding, TRANSFERASE-DNA complex ;; TRANSFERASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3auo__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3auo__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3auo__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	27.67 Å
Rg (electron density)	26.83 Å
Total Rg	27.57 Å
Atom count	5122
Residues	600
Excluded volume	89392 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3auo__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`3auo__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	DNA polymerase beta family (X family)
Molecular weight formula_weight	64204.5 kDa
EC 编号 ec_number	2.7.7.7
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	10378

MRNQELARIFEEIGLMSEFLGDNPFRVRAYHQAARTLYDLDTPIEEIAEKGKEALMELPGVGPDLAEKILEFLRTGKVRKHEELSRKVPRGVLEVMEVPGVGPKTARLLYEGLGIDSLEKLKAALDRGDLTRLKGFGPKRAERIREGLALAQAAGKRRPLGAVLSLARSLLEAIRALPGVERAELCGSARRYKDTVGDLDFLVASREGERAVEGFVRLPQVKEVYAKGKERATVFLKNGLQVDLRVVPPESYGAGLQYLTGSKAHSIRLRALAQEKGLKLSEYGVFRGEKRIAGETEEEVYAALGLPWIPPPLREDQGEVEAALEGRLPKLLELPQVKGDLQVHSTYSDGQNTLEELWEAAKTMGYRYLAVTDHSPAVRVAGGPSPEEALKRVGEIRRFNETHGPPYLLAGAEVDIHPDGTLDYPDWVLRELDLVLVSVHSRFNLPKADQTKRLLKALENPFVHVLAHPTARLLGRRAPIEADWEAVFQKAKEKGVAVEIDGYYDRMDLPDDLARMAYGMGLWISLSTDAHQTDHLRFMELAVGTAQRAWIGPERVLNTLDYEDLLSWLKARRGV

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	300852
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	1-nt gapped DNA
Molecular weight formula_weight	8843.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,E

GCCGTTTTCGGCCCGACTGTTTTCAGTCG

Entity 3 Entity 3 non-polymer

Description description	2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	491.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	134

▼

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

Domain ID domain_id	3auoA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	110 — DNA polymerase beta, N-terminal domain-like

Domain ID domain_id	3auoA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

Domain ID domain_id	3auoA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	10 — Beta Polymerase, domain 2

Domain ID domain_id	3auoA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	210 — Beta Polymerase; domain 3
Homologous superfamily homologous superfamily	10 — DNA polymerase, thumb domain

Domain ID domain_id	3auoA05
Class class	3 — Alpha Beta
Architecture architecture	20 — Alpha-Beta Barrel
Topology topology	20 — TIM Barrel
Homologous superfamily homologous superfamily	140 — Metal-dependent hydrolases

Domain ID domain_id	3auoB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	110 — DNA polymerase beta, N-terminal domain-like

Domain ID domain_id	3auoB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

Domain ID domain_id	3auoB03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	10 — Beta Polymerase, domain 2

Domain ID domain_id	3auoB04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	210 — Beta Polymerase; domain 3
Homologous superfamily homologous superfamily	10 — DNA polymerase, thumb domain

Domain ID domain_id	3auoB05
Class class	3 — Alpha Beta
Architecture architecture	20 — Alpha-Beta Barrel
Topology topology	20 — TIM Barrel
Homologous superfamily homologous superfamily	140 — Metal-dependent hydrolases

▶

Unit-cell length a length_a	95.445 Å
Unit-cell length b length_b	96.941 Å
Unit-cell length c length_c	143.428 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.700 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	0.2437
R_work r_work	0.2410
R_free r_free	0.2933

DNA polymerase X from Thermus thermophilus HB8 ternary complex with 1-nt gapped DNA and ddGTP

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase beta family (X family)

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3auo__assembly_2__model_1

3auo__assembly_2__model_1 | I(q)

3auo__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)

DNA polymerase X from Thermus thermophilus HB8 ternary complex with 1-nt gapped DNA and ddGTP

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase beta family (X family)

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3auo__assembly_2__model_1

3auo__assembly_2__model_1 | I(q)

3auo__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)