SAXSdb — 3b0v

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA-dihydrouridine synthase

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA × 1 FLAVIN MONONUCLEOTIDE × 1	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA × 1 FLAVIN MONONUCLEOTIDE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q5SMC7_THET8
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 22–363； UniProt 1–342 Author chain D； PDBConstruct 22–363； UniProt 1–342

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3b0v
Deposition date deposition_date	2011-06-14
Structure title title	tRNA-dihydrouridine synthase from Thermus thermophilus in complex with tRNA
Keywords keywords	Tim barrel, OXIDOREDUCTASE-RNA complex; OXIDOREDUCTASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3b0v__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3b0v__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3b0v__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	25.75 Å
Rg (electron density)	24.71 Å
Total Rg	25.36 Å
Atom count	4102
Residues	377
Excluded volume	67500 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3b0v__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`3b0v__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	tRNA
Molecular weight formula_weight	24486.6 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	A,B
Atom count atom_count	8204

GCCGAGGUAGCUCAGUUGGUAGAGCAUGCGACUGAAAAUCGCAGUGUCGGCGGUUCGAUUCCGCCCCUCGGCACCA

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	300852
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	tRNA-dihydrouridine synthase
Molecular weight formula_weight	41420.0 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,D

MGSSHHHHHHSQDPLVPRGSHMLDPRLSVAPMVDRTDRHFRFLVRQVSLGVRLYTEMTVDQAVLRGNRERLLAFRPEEHPIALQLAGSDPKSLAEAARIGEAFGYDEINLNLGCPSEKAQEGGYGACLLLDLARVREILKAMGEAVRVPVTVKMRLGLEGKETYRGLAQSVEAMAEAGVKVFVVHARSALLALSTKANREIPPLRHDWVHRLKGDFPQLTFVTNGGIRSLEEALFHLKRVDGVMLGRAVYEDPFVLEEADRRVFGLPRRPSRLEVARRMRAYLEEEVLKGTPPWAVLRHMLNLFRGRPKGRLWRRLLSEGRSLQALDRALRLMEEEVGEEGEKEKPGPRGQREAAPGPAREGV

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	300852
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	FLAVIN MONONUCLEOTIDE
Molecular weight formula_weight	456.3 kDa
Source method src_method	syn
Copy count entity_count	2

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	3b0vC01
Class class	3 — Alpha Beta
Architecture architecture	20 — Alpha-Beta Barrel
Topology topology	20 — TIM Barrel
Homologous superfamily homologous superfamily	70 — Aldolase class I

Domain ID domain_id	3b0vC02
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	120 — Four Helix Bundle (Hemerythrin (Met), subunit A)
Homologous superfamily homologous superfamily	1460 —

Domain ID domain_id	3b0vD01
Class class	3 — Alpha Beta
Architecture architecture	20 — Alpha-Beta Barrel
Topology topology	20 — TIM Barrel
Homologous superfamily homologous superfamily	70 — Aldolase class I

Domain ID domain_id	3b0vD02
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	120 — Four Helix Bundle (Hemerythrin (Met), subunit A)
Homologous superfamily homologous superfamily	1460 —

▶

Unit-cell length a length_a	118.890 Å
Unit-cell length b length_b	118.890 Å
Unit-cell length c length_c	319.550 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 41 21 2
Space-group number int_tables_number	92
Crystal system crystal_system	—

Resolution resolution	3.510 Å
Low-resolution limit resolution_low	48.600 Å
R factor r_factor	—
R_work r_work	0.3000
R_free r_free	0.3200

tRNA-dihydrouridine synthase from Thermus thermophilus in complex with tRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA-dihydrouridine synthase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3b0v__assembly_1__model_1

3b0v__assembly_1__model_1 | I(q)

3b0v__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

tRNA-dihydrouridine synthase from Thermus thermophilus in complex with tRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA-dihydrouridine synthase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3b0v__assembly_1__model_1

3b0v__assembly_1__model_1 | I(q)

3b0v__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)