3ciy

Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Toll-like receptor 3

Mus musculus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 2 其他Polymer 14	46-MER × 1 46-MER × 1 2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose × 4 alpha-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose × 1 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[alpha-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose × 1 ;alpha-D-mannopyranose-(1-3)-[alpha-D-mannopyranose-(1-6)]alpha-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose ; × 1 beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose × 2 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose × 2 beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose × 1 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[beta-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose × 1 ;alpha-D-mannopyranose-(1-3)-[alpha-D-mannopyranose-(1-6)]alpha-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose ; × 1 2-acetamido-2-deoxy-beta-D-glucopyranose × 4	Review required

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TLR3_MOUSE
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–677； UniProt 28–704 Author chain B； PDBConstruct 1–677； UniProt 28–704

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3ciy
Deposition date deposition_date	2008-03-12
Structure title title	Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA
Keywords keywords	;Leucine Rich Repeat, LRR, protein-dsRNA complex, innate immunity, TLR, dsRNA, Glycoprotein, Immune response, Inflammatory response, Leucine-rich repeat, Membrane, Receptor, Transmembrane, IMMUNE SYSTEM-RNA COMPLEX ;; IMMUNE SYSTEM/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3ciy__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3ciy__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3ciy__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	45.66 Å
Rg (electron density)	46.60 Å
Total Rg	46.68 Å
Atom count	13194
Residues	1421
Excluded volume	228910 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3ciy__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (13)

Entity 1 Entity 1 polymer

Description description	46-MER
Molecular weight formula_weight	14781.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	13194

AUUCUGCGGAUUAUUUGGCAAAGGAAGCAUUGACACAUGCGCCAAU

Entity 2 Entity 2 polymer

Description description	46-MER
Molecular weight formula_weight	14655.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	D

AUUGGCGCAUGUGUCAAUGCUUCCUUUGCCAAAUAAUCCGCAGAAU

Entity 3 Entity 3 polymer

Description description	Toll-like receptor 3
Molecular weight formula_weight	79631.3 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

QCTVRYNVADCSHLKLTHIPDDLPSNITVLNLTHNQLRRLPPTNFTRYSQLAILDAGFNSISKLEPELCQILPLLKVLNLQHNELSQISDQTFVFCTNLTELDLMSNSIHKIKSNPFKNQKNLIKLDLSHNGLSSTKLGTGVQLENLQELLLAKNKILALRSEELEFLGNSSLRKLDLSSNPLKEFSPGCFQTIGKLFALLLNNAQLNPHLTEKLCWELSNTSIQNLSLANNQLLATSESTFSGLKWTNLTQLDLSYNNLHDVGNGSFSYLPSLRYLSLEYNNIQRLSPRSFYGLSNLRYLSLKRAFTKQSVSLASHPNIDDFSFQWLKYLEYLNMDDNNIPSTKSNTFTGLVSLKYLSLSKTFTSLQTLTNETFVSLAHSPLLTLNLTKNHISKIANGTFSWLGQLRILDLGLNEIEQKLSGQEWRGLRNIFEIYLSYNKYLQLSTSSFALVPSLQRLMLRRVALKNVDISPSPFRPLRNLTILDLSNNNIANINEDLLEGLENLEILDFQHNNLARLWKRANPGGPVNFLKGLSHLHILNLESNGLDEIPVGVFKNLFELKSINLGLNNLNKLEPFIFDDQTSLRSLNLQKNLITSVEKDVFGPPFQNLNSLDMRFNPFDCTCESISWFVNWINQTHTNISELSTHYLCNTPHHYYGFPLKLFDTSSCKDSAPFENLYFQGHHHHHHWSHPQFEK

Source Source

Source organism organism	Mus musculus
Common name common_name	house mouse
NCBI taxonomy ID ncbi_taxonomy_id	10090
Host organism host_organism	Trichoplusia ni

Entity 4 Entity 4 branched

Description description	2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	424.4 kDa
Source method src_method	man
Copy count entity_count	4

Entity 5 Entity 5 branched

Description description	alpha-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	586.5 kDa
Source method src_method	man
Copy count entity_count	1

Entity 6 Entity 6 branched

Description description	2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[alpha-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	570.5 kDa
Source method src_method	man
Copy count entity_count	1

Entity 7 Entity 7 branched

Description description	;alpha-D-mannopyranose-(1-3)-[alpha-D-mannopyranose-(1-6)]alpha-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose ;
Molecular weight formula_weight	910.8 kDa
Source method src_method	man
Copy count entity_count	1

Entity 8 Entity 8 branched

Description description	beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	586.5 kDa
Source method src_method	man
Copy count entity_count	2

Entity 9 Entity 9 branched

Description description	2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	424.4 kDa
Source method src_method	man
Copy count entity_count	2

Entity 10 Entity 10 branched

Description description	beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	586.5 kDa
Source method src_method	man
Copy count entity_count	1

Entity 11 Entity 11 branched

Description description	2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[beta-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	570.5 kDa
Source method src_method	man
Copy count entity_count	1

Entity 12 Entity 12 branched

Description description	;alpha-D-mannopyranose-(1-3)-[alpha-D-mannopyranose-(1-6)]alpha-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose ;
Molecular weight formula_weight	910.8 kDa
Source method src_method	man
Copy count entity_count	1

Entity 13 Entity 13 non-polymer

Description description	2-acetamido-2-deoxy-beta-D-glucopyranose
Molecular weight formula_weight	221.2 kDa
Source method src_method	man
Copy count entity_count	4

▼

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id	3ciyA00
Class class	3 — Alpha Beta
Architecture architecture	80 — Alpha-Beta Horseshoe
Topology topology	10 — Leucine-rich repeat, LRR (right-handed beta-alpha superhelix)
Homologous superfamily homologous superfamily	10 — Ribonuclease Inhibitor

Domain ID domain_id	3ciyB00
Class class	3 — Alpha Beta
Architecture architecture	80 — Alpha-Beta Horseshoe
Topology topology	10 — Leucine-rich repeat, LRR (right-handed beta-alpha superhelix)
Homologous superfamily homologous superfamily	10 — Ribonuclease Inhibitor

▶

Unit-cell length a length_a	117.846 Å
Unit-cell length b length_b	225.877 Å
Unit-cell length c length_c	259.530 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	3.410 Å
Low-resolution limit resolution_low	47.290 Å
R factor r_factor	0.2880
R_work r_work	0.2880
R_free r_free	0.3330

Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Toll-like receptor 3

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ciy__assembly_1__model_1

3ciy__assembly_1__model_1 | I(q)

3ciy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (13)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 branched

Entity 5 Entity 5 branched

Entity 6 Entity 6 branched

Entity 7 Entity 7 branched

Entity 8 Entity 8 branched

Entity 9 Entity 9 branched

Entity 10 Entity 10 branched

Entity 11 Entity 11 branched

Entity 12 Entity 12 branched

Entity 13 Entity 13 non-polymer

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (1)

Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Toll-like receptor 3

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ciy__assembly_1__model_1

3ciy__assembly_1__model_1 | I(q)

3ciy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (13)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 branched

Entity 5 Entity 5 branched

Entity 6 Entity 6 branched

Entity 7 Entity 7 branched

Entity 8 Entity 8 branched

Entity 9 Entity 9 branched

Entity 10 Entity 10 branched

Entity 11 Entity 11 branched

Entity 12 Entity 12 branched

Entity 13 Entity 13 non-polymer

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (1)