SAXSdb — 3dh3

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribosomal large subunit pseudouridine synthase F

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	stem loop fragment of E. Coli 23S RNA × 1 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	stem loop fragment of E. Coli 23S RNA × 1 water × 2	Consistent with all polymers
3	Protein–RNA	Monomer	Protein 1 RNA 1	stem loop fragment of E. Coli 23S RNA × 1 water × 2	Consistent with all polymers
4	Protein–RNA	Monomer	Protein 1 RNA 1	stem loop fragment of E. Coli 23S RNA × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RLUF_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–290； UniProt 1–290 Author chain B； PDBConstruct 1–290； UniProt 1–290 Author chain C； PDBConstruct 1–290； UniProt 1–290 Author chain D； PDBConstruct 1–290； UniProt 1–290

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3dh3
Deposition date deposition_date	2008-06-16
Structure title title	Crystal Structure of RluF in complex with a 22 nucleotide RNA substrate
Keywords keywords	protein-rna complex, S4 domain, alpha/beta protein, Isomerase, RNA-binding, rRNA processing, ISOMERASE-RNA COMPLEX; ISOMERASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3dh3__assembly_3__model_1

Assembly 3 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3dh3__assembly_3__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3dh3__assembly_3__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	20.26 Å
Rg (electron density)	20.06 Å
Total Rg	20.75 Å
Atom count	2370
Residues	260
Excluded volume	40472 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3dh3__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`3dh3__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`3dh3__assembly_3__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
4	1	`3dh3__assembly_4__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Ribosomal large subunit pseudouridine synthase F
Molecular weight formula_weight	32534.7 kDa
EC 编号 ec_number	5.4.99.-
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	9550

MLPDSSVRLNKYISESGICSRREADRYIEQGNVFLNGKRATIGDQVKPGDVVKVNGQLIEPREAEDLVLIALNKPVGIVSTTEDGERDNIVDFVNHSKRVFPIGRLDKDSQGLIFLTNHGDLVNKILRAGNDHEKEYLVTVDKPITEEFIRGMSAGVPILGTVTKKCKVKKEAPFVFRITLVQGLNRQIRRMCEHFGYEVKKLERTRIMNVSLSGIPLGEWRDLTDDELIDLFKLIENSSSEVKPKAKAKPKTAGIKRPVVKMEKTAEKGGRPASNGKRFTSPGRKKKGR

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	stem loop fragment of E. Coli 23S RNA
Molecular weight formula_weight	7173.3 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	E,F,G,H

AGAACGUCGUGAGACAGUUCGG

Entity 3 Entity 3 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	49

▼

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	3dh3A01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	290 — Structural Genomics Hypothetical 15.5 Kd Protein In mrcA-pckA Intergenic Region; Chain A
Homologous superfamily homologous superfamily	10 — RNA-binding S4 domain

Domain ID domain_id	3dh3A02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	2350 — Pseudouridine synthase
Homologous superfamily homologous superfamily	10 — Pseudouridine synthase

Domain ID domain_id	3dh3B01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	290 — Structural Genomics Hypothetical 15.5 Kd Protein In mrcA-pckA Intergenic Region; Chain A
Homologous superfamily homologous superfamily	10 — RNA-binding S4 domain

Domain ID domain_id	3dh3B02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	2350 — Pseudouridine synthase
Homologous superfamily homologous superfamily	10 — Pseudouridine synthase

Domain ID domain_id	3dh3C01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	290 — Structural Genomics Hypothetical 15.5 Kd Protein In mrcA-pckA Intergenic Region; Chain A
Homologous superfamily homologous superfamily	10 — RNA-binding S4 domain

Domain ID domain_id	3dh3C02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	2350 — Pseudouridine synthase
Homologous superfamily homologous superfamily	10 — Pseudouridine synthase

Domain ID domain_id	3dh3D01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	290 — Structural Genomics Hypothetical 15.5 Kd Protein In mrcA-pckA Intergenic Region; Chain A
Homologous superfamily homologous superfamily	10 — RNA-binding S4 domain

Domain ID domain_id	3dh3D02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	2350 — Pseudouridine synthase
Homologous superfamily homologous superfamily	10 — Pseudouridine synthase

▶

Unit-cell length a length_a	89.552 Å
Unit-cell length b length_b	84.128 Å
Unit-cell length c length_c	91.354 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	94.87 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	3.000 Å
Low-resolution limit resolution_low	49.510 Å
R factor r_factor	0.2336
R_work r_work	0.2312
R_free r_free	0.2790

Crystal Structure of RluF in complex with a 22 nucleotide RNA substrate

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribosomal large subunit pseudouridine synthase F

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3dh3__assembly_3__model_1

3dh3__assembly_3__model_1 | I(q)

3dh3__assembly_3__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)

Crystal Structure of RluF in complex with a 22 nucleotide RNA substrate

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribosomal large subunit pseudouridine synthase F

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3dh3__assembly_3__model_1

3dh3__assembly_3__model_1 | I(q)

3dh3__assembly_3__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)