SAXSdb — 3e0d

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase III subunit alpha

Thermus aquaticus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 2	DNA substrate template strand × 1 DNA substrate primer strand × 1 CALCIUM ION × 1 ;2'-DEOXYADENOSINE 5'-TRIPHOSPHATE ; × 1	Consistent with all polymers
2	Protein–DNA	Monomer	Protein 1 DNA 2	DNA substrate template strand × 1 DNA substrate primer strand × 1 CALCIUM ION × 1 ;2'-DEOXYADENOSINE 5'-TRIPHOSPHATE ; × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPO3A_THEAQ
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–1220； UniProt 1–1220 Author chain B； PDBConstruct 1–1220； UniProt 1–1220

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3e0d
Deposition date deposition_date	2008-07-31
Structure title title	Insights into the Replisome from the Crystral Structure of the Ternary Complex of the Eubacterial DNA Polymerase III alpha-subunit
Keywords keywords	;OB fold, nucleotidyl transferase, polymerase, beta barrel, Cytoplasm, DNA replication, DNA-directed DNA polymerase, Nucleotidyltransferase, Transferase, TRANSFERASE-DNA COMPLEX ;; TRANSFERASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3e0d__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3e0d__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3e0d__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	36.53 Å
Rg (electron density)	36.51 Å
Total Rg	36.81 Å
Atom count	9991
Residues	1186
Excluded volume	175600 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3e0d__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`3e0d__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	DNA substrate template strand
Molecular weight formula_weight	8287.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,E
Atom count atom_count	19982

TTTTTTGTGGCACTGGCCGTCGTTTCG

Entity 2 Entity 2 polymer

Description description	DNA substrate primer strand
Molecular weight formula_weight	6411.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,F

CGAAACGACGGCCAGTGCCAC

Entity 3 Entity 3 polymer

Description description	DNA polymerase III subunit alpha
Molecular weight formula_weight	137614.4 kDa
EC 编号 ec_number	2.7.7.7
Mutation mutation	D20N, D212N, I539F, Q540E, V541A, V542E
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MGSKLKFAHLHQHTQFSLLNGAAKLQDLLKWVKETTPEDPALAMTDHGNLFGAVEFYKKATAMGVKPIIGYEAYVAAESRFDRKRGKGLDGGYFHLTLLAKDFTGYQNLVRLASRAYLEGFYEKPRIDREILREHAQGLIALSGCLGAEIPQFILQDRLDLAEARLNEDLSIFGDRFFIEIQNHGLPEQKKVNQVLKEFARKYGLGMVATNNGHYVRKEDARAHEVLLAIQSKTTLDDPERWRFPCDEFYVKTPEEMRAMLPEAEWGDEPFDNTVEIARMCDVDLPIGDKMVYRIPRFPLPEGRTEAQYLRELTFLGLLRRYPDRITEAFYREVLRLLGTMPPHGDERALAEALARVEEKAWEELRKRLPPLEGVREWTAEAILHRALYELSVIERMGFPGYFLIVQDYINWARGHGVSVGPGRGSAAGSLVAYAVGITNIDPLRFGLLFERFLNPERVSMPDIDTDFSDRERDRVIQYVRERYGEDKVAQIGTFGSLASKAALKDVARVYGIPHKKAEELAKLIPVQFGKPKPLQEAFEAEPELRAEMEKDERIRQVIEVAMRLEGLNRHASVHAAGVVIAAEPLTDLVPLMRDQEGRPVTQYDMGAVEALGLLKMDFLGLRTLTFLDEARRIVKESKGVELDYDRLPLDDPKTFELLSRGETKGVFQLESGGMTATVRGLKPRRLEDIIALVSLYRPGPMEHIPTYIRRHHGQEPVSYAEFPHAEKYLRPILDETYGIPVYQEQIMQIASQVAGYSLGEADLLRRAMGKKRVEEMQKHRERFVRGAKERGVPEEEANRLFDMLEAFANYGFNKSHAAAYSLLSYQTAYVKAHYPVEFMAALLSVERHDSDKVAEYIRDARALGIPVLPPDVNRSGFDFKVVGEEILFGLSAVKNVGEMAARAILEERERGGPFKSLGDFLKRLPEQVVNKRALESLVKAGALDAFGDRARLLASLEPLLRWAAETRERGRSGLVGLFAEVEEPPLVEASPLDEITMLRYEKEALGIYVSGHPVLRYPGLREVASCTIEELSEFVRELPGKPKVLLSGMVEEVVRKPTRSGGMMARFTLSDETGALEVVVFGRAYEGVSPKLKEDIPLLVLAEVEKGEELRVLAQAVWTLEEVLEAPKALEVEVDHALLDEKGVARLKSLLDEHPGSLPVYLRVLGPFGEALFALREVRVGEEALGLLEAEGYRAYLVPDREVFLQGNGGGPKEEVVPF

Source Source

Source organism organism	Thermus aquaticus
NCBI taxonomy ID ncbi_taxonomy_id	271
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	;2'-DEOXYADENOSINE 5'-TRIPHOSPHATE ;
Molecular weight formula_weight	491.2 kDa
Source method src_method	syn
Copy count entity_count	2

▶

Unit-cell length a length_a	149.546 Å
Unit-cell length b length_b	149.546 Å
Unit-cell length c length_c	163.338 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 41
Space-group number int_tables_number	76
Crystal system crystal_system	—

Resolution resolution	4.600 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	—
R_work r_work	0.2870
R_free r_free	0.2710

Insights into the Replisome from the Crystral Structure of the Ternary Complex of the Eubacterial DNA Polymerase III alpha-subunit

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase III subunit alpha

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3e0d__assembly_2__model_1

3e0d__assembly_2__model_1 | I(q)

3e0d__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)

Insights into the Replisome from the Crystral Structure of the Ternary Complex of the Eubacterial DNA Polymerase III alpha-subunit

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase III subunit alpha

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3e0d__assembly_2__model_1

3e0d__assembly_2__model_1 | I(q)

3e0d__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)