SAXSdb — 3ecp

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tn5 transposase

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 4	DNA transferred strand × 2 DNA non-transferred strand × 2 GLYCEROL × 6 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q08JA5_ECOLX
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–476； UniProt 5–480

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3ecp
Deposition date deposition_date	2008-09-01
Structure title title	Crystal Structure Of Tn5 Transposase Complexed With 5' Phosphorylated Transposon End DNA
Keywords keywords	TRANSPOSASE, RIBONUCLEASE H-LIKE MOTIF, PROTEIN-DNA COMPLEX, SYNAPTIC COMPLEX, DNA RECOMBINATION-DNA COMPLEX; DNA RECOMBINATION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3ecp__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3ecp__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3ecp__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	33.27 Å
Rg (electron density)	32.57 Å
Total Rg	33.13 Å
Atom count	8882
Residues	996
Excluded volume	152790 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3ecp__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Tn5 transposase
Molecular weight formula_weight	53367.0 kDa
Mutation mutation	E54K, M56A, L372P, G477
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	4572

MITSALHRAADWAKSVFSSAALGDPRRTARLVNVAAQLAKYSGKSITISSEGSKAAQEGAYRFIRNPNVSAEAIRKAGAMQTVKLAQEFPELLAIEDTTSLSYRHQVAEELGKLGSIQDKSRGWWVHSVLLLEATTFRTVGLLHQEWWMRPDDPADADEKESGKWLAAAATSRLRMGSMMSNVIAVCDREADIHAYLQDKLAHNERFVVRSKHPRKDVESGLYLYDHLKNQPELGGYQISIPQKGVVDKRGKRKNRPARKASLSLRSGRITLKQGNITLNAVLAEEINPPKGETPLKWLLLTSEPVESLAQALRVIDIYTHRWRIEEFHKAWKTGAGAERQRMEEPDNLERMVSILSFVAVRLLQLRESFTPPQALRAQGLLKEAEHVESQSAETVLTPDECQLLGYLDKGKRKRKEKAGSLQWAYMAIARLGGFMDSKRTGIASWGALWEGWEALQSKLDGFLAAKDLMAQGIKIG

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA transferred strand
Molecular weight formula_weight	6213.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

GACTTGTGTATAAGAGTCAG

Entity 3 Entity 3 polymer

Description description	DNA non-transferred strand
Molecular weight formula_weight	6052.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

CTGACTCTTATACACAAGTC

Entity 4 Entity 4 non-polymer

Description description	GLYCEROL
Molecular weight formula_weight	92.1 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	120

▼

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d3ecpa2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.55 — Ribonuclease H-like motif
Superfamily Superfamily superfamily	c.55.3 — Ribonuclease H-like
Family Family family	c.55.3.4 — Transposase inhibitor (Tn5 transposase)

Domain ID domain_id	d3ecpa3
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

CATH v4.4 (3 domains)

Domain ID domain_id	3ecpA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	246 — Serum Albumin; Chain A, Domain 1
Homologous superfamily homologous superfamily	40 — Tn5 transposase; domain 1

Domain ID domain_id	3ecpA02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	350 — Transposase Inhibitor Protein From Tn5; Chain A, domain 1
Homologous superfamily homologous superfamily	10 — Transposase Inhibitor Protein From Tn5; Chain A, domain 1

Domain ID domain_id	3ecpA03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	740 — Transferase Inhibitor Protein From Tn5; Chain A, domain2
Homologous superfamily homologous superfamily	10 — Transferase Inhibitor Protein From Tn5; Chain

▶

Unit-cell length a length_a	113.508 Å
Unit-cell length b length_b	113.508 Å
Unit-cell length c length_c	228.775 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 65 2 2
Space-group number int_tables_number	179
Crystal system crystal_system	—

Resolution resolution	2.500 Å
Low-resolution limit resolution_low	30.000 Å
R factor r_factor	0.2215
R_work r_work	0.2188
R_free r_free	0.2739

Crystal Structure Of Tn5 Transposase Complexed With 5' Phosphorylated Transposon End DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tn5 transposase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ecp__assembly_1__model_1

3ecp__assembly_1__model_1 | I(q)

3ecp__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (2 domains)

CATH v4.4 (3 domains)

7. Citations (1)

Crystal Structure Of Tn5 Transposase Complexed With 5' Phosphorylated Transposon End DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tn5 transposase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ecp__assembly_1__model_1

3ecp__assembly_1__model_1 | I(q)

3ecp__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (2 domains)

CATH v4.4 (3 domains)

7. Citations (1)