3eh8

Crystal structure of Y2 I-AniI variant (F13Y/S111Y)/DNA complex with calcium

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Intron-encoded DNA endonuclease I-AniI

Emericella nidulans

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 2	31-MER × 1 31-MER × 1 CALCIUM ION × 2 water × 3	Consistent with all polymers
2	Protein–DNA	Monomer	Protein 1 DNA 2	31-MER × 1 31-MER × 1 CALCIUM ION × 2 water × 3	Consistent with all polymers
3	Protein–DNA	Monomer	Protein 1 DNA 2	31-MER × 1 31-MER × 1 CALCIUM ION × 2 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ANI1_EMENI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 3–254； UniProt 237–488 Author chain D； PDBConstruct 3–254； UniProt 237–488 Author chain G； PDBConstruct 3–254； UniProt 237–488

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3eh8
Deposition date deposition_date	2008-09-11
Structure title title	Crystal structure of Y2 I-AniI variant (F13Y/S111Y)/DNA complex with calcium
Keywords keywords	;Protein-DNA complex, Endonuclease, Hydrolase, Intron homing, Mitochondrion, mRNA processing, mRNA splicing, Nuclease, HYDROLASE-DNA COMPLEX ;; HYDROLASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3eh8__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3eh8__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3eh8__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	26.77 Å
Rg (electron density)	25.19 Å
Total Rg	25.89 Å
Atom count	3358
Residues	316
Excluded volume	56582 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3eh8__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`3eh8__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`3eh8__assembly_3__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Intron-encoded DNA endonuclease I-AniI
Molecular weight formula_weight	29611.5 kDa
EC 编号 ec_number	3.1.-.-
Mutation mutation	F13Y, F80K, S111Y, L232K
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,D,G
Atom count atom_count	10141

GSDLTYAYLVGLYEGDGYFSITKKGKYLTYELGIELSIKDVQLIYKIKKILGIGIVSFRKRNEIEMVALRIRDKNHLKSKILPIFEKYPMFSNKQYDYLRFRNALLSGIIYLEDLPDYTRSDEPLNSIESIINTSYFSAWLVGFIEAEGCFSVYKLNKDDDYLIASFDIAQRDGDILISAIRKYLSFTTKVYLDKTNCSKLKVTSVRSVENIIKFLQNAPVKLLGNKKLQYKLWLKQLRKISRYSEKIKIPSNY

Source Source

Source organism organism	Emericella nidulans
Common name common_name	Aspergillus nidulans
NCBI taxonomy ID ncbi_taxonomy_id	162425
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	31-MER
Molecular weight formula_weight	9609.2 kDa
Source method src_method	syn
Copy count entity_count	3

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B,E,H

GCGCGCTGAGGAGGTTTCTCTGTAAAGCGCA

Entity 3 Entity 3 polymer

Description description	31-MER
Molecular weight formula_weight	9458.1 kDa
Source method src_method	syn
Copy count entity_count	3

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,F,I

GCGCTTTACAGAGAAACCTCCTCAGCGCGCT

Entity 4 Entity 4 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	67

▼

6. Fold Classification (SCOP + CATH) 15 domains

SCOP 2.08 (9 domains)

Domain ID domain_id	d3eh8a1
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d3eh8a2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d3eh8a3
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

Domain ID domain_id	d3eh8d1
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d3eh8d2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d3eh8d3
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

Domain ID domain_id	d3eh8g1
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d3eh8g2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.1 — Group I mobile intron endonuclease

Domain ID domain_id	d3eh8g3
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

CATH v4.4 (6 domains)

Domain ID domain_id	3eh8A01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

Domain ID domain_id	3eh8A02
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

Domain ID domain_id	3eh8D01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

Domain ID domain_id	3eh8D02
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

Domain ID domain_id	3eh8G01
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

Domain ID domain_id	3eh8G02
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

▶

Unit-cell length a length_a	107.555 Å
Unit-cell length b length_b	192.603 Å
Unit-cell length c length_c	161.800 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	24

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.700 Å
Low-resolution limit resolution_low	37.140 Å
R factor r_factor	0.2006
R_work r_work	0.1978
R_free r_free	0.2532

Crystal structure of Y2 I-AniI variant (F13Y/S111Y)/DNA complex with calcium

1. Protein Identity and Related Structures Protein Identity & Related Structures

Intron-encoded DNA endonuclease I-AniI

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3eh8__assembly_1__model_1

3eh8__assembly_1__model_1 | I(q)

3eh8__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 15 domains

SCOP 2.08 (9 domains)

CATH v4.4 (6 domains)

7. Citations (1)

Crystal structure of Y2 I-AniI variant (F13Y/S111Y)/DNA complex with calcium

1. Protein Identity and Related Structures Protein Identity & Related Structures

Intron-encoded DNA endonuclease I-AniI

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3eh8__assembly_1__model_1

3eh8__assembly_1__model_1 | I(q)

3eh8__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 15 domains

SCOP 2.08 (9 domains)

CATH v4.4 (6 domains)

7. Citations (1)