SAXSdb — 3ouy

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-Adding Enzyme

OrganismNot specified

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 2	RNA (35-MER) × 2 SULFATE ION × 3 1,2-ETHANEDIOL × 1 PYROPHOSPHATE 2- × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	CCA_ARCFU
Isoform	—
PDB entities	1, 2
Chains and sequence ranges	Author chain A； PDBConstruct 1–437； UniProt 1–437 Author chain B； PDBConstruct 1–437； UniProt 1–437

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3ouy
Deposition date deposition_date	2010-09-15
Structure title title	How the CCA-adding Enzyme Selects Adenine Over Cytosine at Position 76 of tRNA
Keywords keywords	Protein-RNA complex, Rossmann Fold, CCA-Adding, tRNA, Phospholation, Transferase-RNA complex; Transferase/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3ouy__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3ouy__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3ouy__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	38.15 Å
Rg (electron density)	39.42 Å
Total Rg	39.49 Å
Atom count	8805
Residues	948
Excluded volume	151710 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3ouy__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	CCA-Adding Enzyme
Molecular weight formula_weight	51909.8 kDa
EC 编号 ec_number	2.7.7.25, 2.7.7.21
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	8942

MKVEEILEKALELVIPDEEEVRKGREAEEELRRRLDELGVEYVFVGSYARNTWLKGSLEIDVFLLFPEEFSKEELRERGLEIGKAVLDSYEIRYAEHPYVHGVVKGVEVDVVPCYKLKEPKNIKSAVDRTPFHHKWLEGRIKGKENEVRLLKGFLKANGIYGAEYKVRGFSGYLCELLIVFYGSFLETVKNARRWTRRTVIDVAKGEVRKGEEFFVVDPVDEKRNVAANLSLDNLARFVHLCREFMEAPSLGFFKPKHPLEIEPERLRKIVEERGTAVFAVKFRKPDIVDDNLYPQLERASRKIFEFLERENFMPLRSAFKASEEFCYLLFECQIKEISRVFRRMGPQFEDERNVKKFLSRNRAFRPFIENGRWWAFEMRKFTTPEEGVRSYASTHWHTLGKNVGESIREYFEIISGEKLFKEPVTAELCEMMGVKDCCCM

Entity 2 Entity 2 polymer

Description description	CCA-Adding Enzyme
Molecular weight formula_weight	51469.1 kDa
EC 编号 ec_number	2.7.7.25, 2.7.7.21
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MKVEEILEKALELVIPDEEEVRKGREAEEELRRRLDELGVEYVFVGSYARNTWLKGSLEIDVFLLFPEEFSKEELRERGLEIGKAVLDSYEIRYAEHPYVHGVVKGVEVDVVPCYKLKEPKNIKSAVDRTPFHHKWLEGRIKGKENEVRLLKGFLKANGIYGAEYKVRGFSGYLCELLIVFYGSFLETVKNARRWTRRTVIDVAKGEVRKGEEFFVVDPVDEKRNVAANLSLDNLARFVHLCREFMEAPSLGFFKPKHPLEIEPERLRKIVEERGTAVFAVKFRKPDIVDDNLYPQLERASRKIFEFLERENFMPLRSAFKASEEFCYLLFECQIKEISRVFRRMGPQFEDERNVKKFLSRNRAFRPFIENGRWWAFEMRKFTTPEEGVRSYASTHWHTLGKNVGESIREYFEIISGEKLFKEPVTAELCEMMGVKD

Entity 3 Entity 3 polymer

Description description	RNA (35-MER)
Molecular weight formula_weight	11166.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,D

GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACCA

Entity 4 Entity 4 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 non-polymer

Description description	1,2-ETHANEDIOL
Molecular weight formula_weight	62.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	PYROPHOSPHATE 2-
Molecular weight formula_weight	176.0 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 7 Entity 7 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	137

▼

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	3ouyA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	30 — CCA tRNA nucleotidyltransferase, domain 2

Domain ID domain_id	3ouyA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	10 — Beta Polymerase, domain 2

Domain ID domain_id	3ouyA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	590 — Poly(A) polymerase predicted RNA binding domain

Domain ID domain_id	3ouyA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	1550 — Archaeal tRNA CCA-adding enzyme catalytic domain

Domain ID domain_id	3ouyB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	30 — CCA tRNA nucleotidyltransferase, domain 2

Domain ID domain_id	3ouyB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	10 — Beta Polymerase, domain 2

Domain ID domain_id	3ouyB03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	590 — Poly(A) polymerase predicted RNA binding domain

Domain ID domain_id	3ouyB04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	1550 — Archaeal tRNA CCA-adding enzyme catalytic domain

▶

Unit-cell length a length_a	111.217 Å
Unit-cell length b length_b	228.075 Å
Unit-cell length c length_c	58.459 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	2.690 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	0.2094
R_work r_work	0.2065
R_free r_free	0.2637

How the CCA-adding Enzyme Selects Adenine Over Cytosine at Position 76 of tRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-Adding Enzyme

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ouy__assembly_1__model_1

3ouy__assembly_1__model_1 | I(q)

3ouy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)

How the CCA-adding Enzyme Selects Adenine Over Cytosine at Position 76 of tRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-Adding Enzyme

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ouy__assembly_1__model_1

3ouy__assembly_1__model_1 | I(q)

3ouy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)