SAXSdb — 3wqz

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Alanine--tRNA ligase

Archaeoglobus fulgidus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 1	RNA (75-MER) × 1 '5'-O-(N-(L-ALANYL)-SULFAMOYL)ADENOSINE × 2 ZINC ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYA_ARCFU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–906； UniProt 1–906 Author chain B； PDBConstruct 1–906； UniProt 1–906

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3wqz
Deposition date deposition_date	2014-02-05
Structure title title	Crystal structure of Archaeoglobus fulgidus alanyl-tRNA synthetase in complex with a tRNA(Ala) variant having A3.U70
Keywords keywords	aminoacyl-tRNA synthetases, protein-RNA complex, homodimer, ligase, alanyladenylate analogue, LIGASE-RNA complex; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3wqz__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3wqz__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3wqz__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	50.89 Å
Rg (electron density)	51.59 Å
Total Rg	51.53 Å
Atom count	16078
Residues	1884
Excluded volume	280490 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3wqz__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Alanine--tRNA ligase
Molecular weight formula_weight	102679.6 kDa
EC 编号 ec_number	6.1.1.7
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	16078

MTLDEEYLDITFLTENGFVRKRCPKCGKHFWTADPEREICGDPPCESYSFIGNPVFKKPFELDEMREYYLNFFERRGHGRIERYPVVARWRTDIYLTIASIADFQPFVTSGVAPPPANPLTISQPCIRLDDLDSVGRTGRHLTLFEMMAHHAFNYPGKEIYWKNETVAYCTELLNELGVKKEDIVYKEEPWAGGGNAGPCLEAIVGGLEVATLVFMNLEEHPEGDIEIKGARYRKMDNYIVDTGYGLERFVWASKGTPTVYDAIFPEVVDTIIDNSNVSFNREDERVRRIVAESSKLAGIMGELRGERLNQLRKSVADTVGVSVEELEGIVVPLEKVYSLADHTRCILFMLGDGLVPSNAGAGYLARLMIRRSLRLAEELELGLDLYDLVEMHKKILGFEFDVPLSTVQEILELEKERYRTTVSKGTRLVERLVERKKKLEKDDLIELYDSHGIPVELAVGIAAEKGAEVEMPKDIYAELAKRHSKAEKVQEKKITLQNEYPATEKLYYDDPTLLEFEAEVIGVEGDFVILNRSAFYPESGGQDNDVGYLIANGGKFEVVDVLEADGVVLHVVKGAKPEVGTKVKGVIDSDVRWRHMRHHSATHVLLYSLQKVLGNHVWQAGARKEFSKARLDVTHFRRPSEEEIKEIEMLANREILANKPIKWEWMDRIEAERKFGFRLYQGGVPPGRKIRVVQVGDDVQACGGTHCRSTGEIGMLKILKVESIQDGVIRFEFAAGEAAIEAVEEMERLLREASSILRVEPAKLPKTVERFFEEWKDQRKEIERLKSVIADLWADILMERAEEFDSMKVVAEVVDADMQALQKLAERLAEKGAVGCLMAKGEGKVFVVTFSGQKYDARELLREIGRVAKGSGGGRKDVAQGAVQQLLDREEMLDVIFRFLSEHEG

Source Source

Source organism organism	Archaeoglobus fulgidus
NCBI taxonomy ID ncbi_taxonomy_id	224325
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RNA (75-MER)
Molecular weight formula_weight	24246.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C

GGACUCGUAGCUCAGCGGGAGAGCGCCGCCUUUGCGAGGCGGAGGCCGCGGGUUCAAAUCCCGCCGAGUCCACCA

Entity 3 Entity 3 non-polymer

Description description	'5'-O-(N-(L-ALANYL)-SULFAMOYL)ADENOSINE
Molecular weight formula_weight	417.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

▼

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

Domain ID domain_id	3wqzA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	3wqzA03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	130 —

Domain ID domain_id	3wqzA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	980 — Threonyl-tRNA Synthetase; Chain A, domain 2
Homologous superfamily homologous superfamily	10 — Threonyl-trna Synthetase; Chain A, domain 2

Domain ID domain_id	3wqzA05
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	54 — Replication Terminator Protein; Chain A, domain 2
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	3wqzA06
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	310 — Diaminopimelate Epimerase; Chain A, domain 1
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	3wqzB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	3wqzB03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	130 —

Domain ID domain_id	3wqzB04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	980 — Threonyl-tRNA Synthetase; Chain A, domain 2
Homologous superfamily homologous superfamily	10 — Threonyl-trna Synthetase; Chain A, domain 2

Domain ID domain_id	3wqzB05
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	54 — Replication Terminator Protein; Chain A, domain 2
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	3wqzB06
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	310 — Diaminopimelate Epimerase; Chain A, domain 1
Homologous superfamily homologous superfamily	40 —

▶

Unit-cell length a length_a	99.609 Å
Unit-cell length b length_b	169.676 Å
Unit-cell length c length_c	176.649 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.489 Å
Low-resolution limit resolution_low	42.738 Å
R factor r_factor	0.2431
R_work r_work	0.2413
R_free r_free	0.2765

Crystal structure of Archaeoglobus fulgidus alanyl-tRNA synthetase in complex with a tRNA(Ala) variant having A3.U70

1. Protein Identity and Related Structures Protein Identity & Related Structures

Alanine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3wqz__assembly_1__model_1

3wqz__assembly_1__model_1 | I(q)

3wqz__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)

Crystal structure of Archaeoglobus fulgidus alanyl-tRNA synthetase in complex with a tRNA(Ala) variant having A3.U70

1. Protein Identity and Related Structures Protein Identity & Related Structures

Alanine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3wqz__assembly_1__model_1

3wqz__assembly_1__model_1 | I(q)

3wqz__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)