SAXSdb — 4fcy

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transposase

Enterobacteria phage Mu

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 6	DNA (68-MER) × 2 DNA (13-MER) × 2 DNA (49-MER) × 2	Consistent with all polymers
2	Protein–DNA	Homooligomer	Protein 8 DNA 12	DNA (68-MER) × 4 DNA (13-MER) × 4 DNA (49-MER) × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TRA_BPMU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–529； UniProt 77–605 Author chain B； PDBConstruct 1–529； UniProt 77–605

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4fcy
Deposition date deposition_date	2012-05-25
Structure title title	Crystal structure of the bacteriophage Mu transpososome
Keywords keywords	RNaseH, DDE transposase, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4fcy__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4fcy__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4fcy__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	81.90 Å
Rg (electron density)	81.93 Å
Total Rg	82.16 Å
Atom count	40224
Residues	4196
Excluded volume	680150 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4fcy__assembly_1__model_1`	decameric （10）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4fcy__assembly_2__model_1`	eicosameric （20）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Transposase
Molecular weight formula_weight	60034.3 kDa
Mutation mutation	M521L, N525L
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	10056

IARPTLEAHDYDREALWSKWDNASDSQRRLAEKWLPAVQAADEMLNQGISTKTAFATVAGHYQVSASTLRDKYYQVQKFAKPDWAAALVDGRGASRRNVHKSEFDEDAWQFLIADYLRPEKPAFRKCYERLELAAREHGWSIPSRATAFRRIQQLDEAMVVACREGEHALMHLIPAQQRTVEHLDAMQWINGDGYLHNVFVRWFNGDVIRPKTWFWQDVKTRKILGWRCDVSENIDSIRLSFMDVVTRYGIPEDFHITIDNTRGAANKWLTGGAPNRYRFKVKEDDPKGLFLLMGAKMHWTSVVAGKGWGQAKPVERAFGVGGLEEYVDKHPALAGAYTGPNPQAKPDNYGDRAVDAELFLKTLAEGVAMFNARTGRETEMCGGKLSFDDVFEREYARTIVRKPTEEQKRMLLLPAEAVNVSRKGEFTLKVGGSLKGAKNVYYNLALMLAGVKKVVVRFDPQQLHSTVYCYTLDGRFICEAECLAPVAFNDAAAGREYRRRQKQLKSATKAAIKAQKQMDALEVAELLP

Source Source

Source organism organism	Enterobacteria phage Mu
NCBI taxonomy ID ncbi_taxonomy_id	10677
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA (68-MER)
Molecular weight formula_weight	20912.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTTCGTGCGCCGCTTCATCTGATGTGTTGTTGACG

Entity 3 Entity 3 polymer

Description description	DNA (13-MER)
Molecular weight formula_weight	3913.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

CGTCAACAACACA

Entity 4 Entity 4 polymer

Description description	DNA (49-MER)
Molecular weight formula_weight	15200.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

GAAGCGGCGCACGAAAAACGCGAAAGCGTTTCACGATAAATGCGAAAAC

▼

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	4fcyA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	60 — Homeodomain-like

Domain ID domain_id	4fcyA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	60 — Homeodomain-like

Domain ID domain_id	4fcyA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4fcyB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	60 — Homeodomain-like

Domain ID domain_id	4fcyB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	60 — Homeodomain-like

Domain ID domain_id	4fcyB03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4fcyB04
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	130 — Transposase, Mu, C-terminal

Domain ID domain_id	4fcyB05
Class class	6 — Special
Architecture architecture	10 — Helix non-globular
Topology topology	250 — Single alpha-helices involved in coiled-coils or other helix-helix interfaces
Homologous superfamily homologous superfamily	2550 —

▶

Unit-cell length a length_a	196.138 Å
Unit-cell length b length_b	196.138 Å
Unit-cell length c length_c	349.980 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	32

Space group space_group	I 41 2 2
Space-group number int_tables_number	98
Crystal system crystal_system	—

Resolution resolution	3.706 Å
Low-resolution limit resolution_low	49.035 Å
R factor r_factor	0.3951
R_work r_work	0.3928
R_free r_free	0.4374

Crystal structure of the bacteriophage Mu transpososome

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transposase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4fcy__assembly_2__model_1

4fcy__assembly_2__model_1 | I(q)

4fcy__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)

Crystal structure of the bacteriophage Mu transpososome

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transposase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4fcy__assembly_2__model_1

4fcy__assembly_2__model_1 | I(q)

4fcy__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)