4k4z

Coxsackievirus B3 polymerase elongation complex (r2_Mg_form)

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-dependent RNA polymerase

Human coxsackievirus B3

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 3	;RNA (5'-R(APAPGPUPCPUPCPCPAPGPGPUPCPUPCPUPCPGPUPCPGPAPAPA)-3') ; × 1 ;RNA (5'-R(UPGPUPUPCPGPAPCPGPAPGPAPGPA)-3') ; × 1 ;RNA (5'-R(PGPGPGPAPGPAPUPGP*A)-3') ; × 1 MAGNESIUM ION × 1 water × 3	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 3	;RNA (5'-R(APAPGPUPCPUPCPCPAPGPGPUPCPUPCPUPCPGPUPCPGPAPAPA)-3') ; × 1 ;RNA (5'-R(UPGPUPUPCPGPAPCPGPAPGPAPGPA)-3') ; × 1 ;RNA (5'-R(PGPGPGPAPGPAPUPGP*A)-3') ; × 1 MAGNESIUM ION × 1 water × 3	Consistent with all polymers
3	Protein–RNA	Monomer	Protein 1 RNA 3	;RNA (5'-R(APAPGPUPCPUPCPCPAPGPGPUPCPUPCPUPCPGPUPCPGPAPAPA)-3') ; × 1 ;RNA (5'-R(UPGPUPUPCPGPAPCPGPAPGPAPGPA)-3') ; × 1 ;RNA (5'-R(PGPGPGPAPGPAPUPGP*A)-3') ; × 1 MAGNESIUM ION × 1 water × 3	Consistent with all polymers
4	Protein–RNA	Monomer	Protein 1 RNA 3	;RNA (5'-R(APAPGPUPCPUPCPCPAPGPGPUPCPUPCPUPCPGPUPCPGPAPAPA)-3') ; × 1 ;RNA (5'-R(UPGPUPUPCPGPAPCPGPAPGPAPGPA)-3') ; × 1 ;RNA (5'-R(PGPGPGPAPGPAPUPGP*A)-3') ; × 1 MAGNESIUM ION × 1 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q66338_9ENTO
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–462； UniProt 1724–2185 Author chain E； PDBConstruct 1–462； UniProt 1724–2185 Author chain I； PDBConstruct 1–462； UniProt 1724–2185 Author chain M； PDBConstruct 1–462； UniProt 1724–2185

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4k4z
Deposition date deposition_date	2013-04-12
Structure title title	Coxsackievirus B3 polymerase elongation complex (r2_Mg_form)
Keywords keywords	polymerase, RNA-dependent RNA polymerase, protein-RNA complex, Transferase-rna complex; Transferase/rna
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4k4z__assembly_3__model_1

Assembly 3 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4k4z__assembly_3__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4k4z__assembly_3__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	24.35 Å
Rg (electron density)	23.41 Å
Total Rg	24.23 Å
Atom count	4419
Residues	496
Excluded volume	76358 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4k4z__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4k4z__assembly_2__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`4k4z__assembly_3__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
4	1	`4k4z__assembly_4__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	RNA-dependent RNA polymerase
Molecular weight formula_weight	53624.2 kDa
EC 编号 ec_number	2.7.7.48
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,E,I,M
Atom count atom_count	18903

GEIEFIESSKDAGFPVINTPSKTKLEPSVFHQVFEGNKEPAVLRSGDPRLKANFEEAIFSKYIGNVNTHVDEYMLEAVDHYAGQLATLDISTEPMKLEDAVYGTEGLEALDLTTSAGYPYVALGIKKRDILSKKTKDLTKLKECMDKYGLNLPMVTYVKDELRSIEKVAKGKSRLIEASSLNDSVAMRQTFGNLYKTFHLNPGVVTGSAVGCDPDLFWSKIPVMLDGHLIAFDYSGYDASLSPVWFACLKMILEKLGYTHKETNYIDYLCNSHHLYRDKHYFVRGGMPSGCSGTSIFNSMINNIIIRTLMLKVYKGIDLDQFRMIAYGDDVIASYPWPIDASLLAEAGKGYGLIMTPADKGECFNEVTWTNVTFLKRYFRADEQYPFLVHPVMPMKDIHESIRWTKDPKNTQDHVRSLCLLAWHNGEHEYEEFIRKIRSVPVGRCLTLPAFSTLRRKWLDSFGSSSHHHHHH

Source Source

Source organism organism	Human coxsackievirus B3
NCBI taxonomy ID ncbi_taxonomy_id	12072
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;RNA (5'-R(APAPGPUPCPUPCPCPAPGPGPUPCPUPCPUPCPGPUPCPGPAPAPA)-3') ;
Molecular weight formula_weight	7629.6 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,F,J,N

AAGUCUCCAGGUCUCUCGUCGAAA

Entity 3 Entity 3 polymer

Description description	;RNA (5'-R(UPGPUPUPCPGPAPCPGPAPGPAPGPA)-3') ;
Molecular weight formula_weight	4526.8 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,G,K,O

UGUUCGACGAGAGA

Entity 4 Entity 4 polymer

Description description	;RNA (5'-R(PGPGPGPAPGPAPUPGP*A)-3') ;
Molecular weight formula_weight	2974.9 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	D,L,H,P

GGGAGAUGA

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	1266

▼

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d4k4za_
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.8 — DNA/RNA polymerases
Superfamily Superfamily superfamily	e.8.1 — DNA/RNA polymerases
Family Family family	e.8.1.4 — RNA-dependent RNA-polymerase

Domain ID domain_id	d4k4ze_
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.8 — DNA/RNA polymerases
Superfamily Superfamily superfamily	e.8.1 — DNA/RNA polymerases
Family Family family	e.8.1.4 — RNA-dependent RNA-polymerase

Domain ID domain_id	d4k4zi_
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.8 — DNA/RNA polymerases
Superfamily Superfamily superfamily	e.8.1 — DNA/RNA polymerases
Family Family family	e.8.1.4 — RNA-dependent RNA-polymerase

Domain ID domain_id	d4k4zm_
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.8 — DNA/RNA polymerases
Superfamily Superfamily superfamily	e.8.1 — DNA/RNA polymerases
Family Family family	e.8.1.4 — RNA-dependent RNA-polymerase

CATH v4.4 (8 domains)

Domain ID domain_id	4k4zA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	270 — Reverse transcriptase/Diguanylate cyclase domain

Domain ID domain_id	4k4zA03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	960 — Mitochondrial Import Receptor Subunit Tom20; Chain A
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4k4zE02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	270 — Reverse transcriptase/Diguanylate cyclase domain

Domain ID domain_id	4k4zE03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	960 — Mitochondrial Import Receptor Subunit Tom20; Chain A
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4k4zI02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	270 — Reverse transcriptase/Diguanylate cyclase domain

Domain ID domain_id	4k4zI03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	960 — Mitochondrial Import Receptor Subunit Tom20; Chain A
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4k4zM02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	270 — Reverse transcriptase/Diguanylate cyclase domain

Domain ID domain_id	4k4zM03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	960 — Mitochondrial Import Receptor Subunit Tom20; Chain A
Homologous superfamily homologous superfamily	20 —

▶

Unit-cell length a length_a	60.641 Å
Unit-cell length b length_b	60.633 Å
Unit-cell length c length_c	194.680 Å
Unit-cell angle α angle_alpha	89.98 °
Unit-cell angle β angle_beta	89.92 °
Unit-cell angle γ angle_gamma	78.68 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.170 Å
Low-resolution limit resolution_low	45.580 Å
R factor r_factor	0.2060
R_work r_work	0.2040
R_free r_free	0.2440

Coxsackievirus B3 polymerase elongation complex (r2_Mg_form)

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-dependent RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4k4z__assembly_3__model_1

4k4z__assembly_3__model_1 | I(q)

4k4z__assembly_3__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (4 domains)

CATH v4.4 (8 domains)

7. Citations (1)

Coxsackievirus B3 polymerase elongation complex (r2_Mg_form)

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-dependent RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4k4z__assembly_3__model_1

4k4z__assembly_3__model_1 | I(q)

4k4z__assembly_3__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (4 domains)

CATH v4.4 (8 domains)

7. Citations (1)