SAXSdb — 4kfc

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

KDP operon transcriptional regulatory protein KdpE

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 2	Promoter DNA × 1 Promoter DNA × 1 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	KDPE_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 5–227； UniProt 3–225 Author chain B； PDBConstruct 5–227； UniProt 3–225

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4kfc
Deposition date deposition_date	2013-04-26
Structure title title	Crystal structure of a hyperactive mutant of response regulator KdpE complexed to its promoter DNA
Keywords keywords	receiver domain, DNA-binding domain, TRANSCRIPTION REGULATOR-DNA complex; TRANSCRIPTION REGULATOR/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4kfc__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4kfc__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4kfc__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	33.92 Å
Rg (electron density)	32.41 Å
Total Rg	33.02 Å
Atom count	4763
Residues	507
Excluded volume	80975 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4kfc__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	KDP operon transcriptional regulatory protein KdpE
Molecular weight formula_weight	25437.2 kDa
Mutation mutation	E216A
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	4911

GAMANVLIVEDEQAIRRFLRTALEGDGMRVFEAETLQRGLLEAATRKPDLIILDLGLPDGDGIEFIRDLRQWSAVPVIVLSARSEESDKIAALDAGADDYLSKPFGIGELQARLRVALRRHSATTAPDPLVKFSDVTVDLAARVIHRGEEEVHLTPIEFRLLAVLLNNAGKVLTQRQLLNQVWGPNAVEHSHYLRIYMGHLRQKLEQDPARPRHFITATGIGYRFML

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Promoter DNA
Molecular weight formula_weight	9025.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Y

CATTTTTATACTTTTTTTACACCCCGCCCG

Entity 3 Entity 3 polymer

Description description	Promoter DNA
Molecular weight formula_weight	9418.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Z

CGGGCGGGGTGTAAAAAAAGTATAAAAATG

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	148

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	4kfcA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	4kfcA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	4kfcB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	4kfcB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

▶

Unit-cell length a length_a	132.770 Å
Unit-cell length b length_b	132.770 Å
Unit-cell length c length_c	134.510 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 43 21 2
Space-group number int_tables_number	96
Crystal system crystal_system	—

Resolution resolution	2.530 Å
Low-resolution limit resolution_low	44.320 Å
R factor r_factor	0.2080
R_work r_work	0.2038
R_free r_free	0.2450

Crystal structure of a hyperactive mutant of response regulator KdpE complexed to its promoter DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

KDP operon transcriptional regulatory protein KdpE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4kfc__assembly_1__model_1

4kfc__assembly_1__model_1 | I(q)

4kfc__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Crystal structure of a hyperactive mutant of response regulator KdpE complexed to its promoter DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

KDP operon transcriptional regulatory protein KdpE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4kfc__assembly_1__model_1

4kfc__assembly_1__model_1 | I(q)

4kfc__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)