SAXSdb — 4qei

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glycine--tRNA ligase

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 2	tRNA-Gly-CCC-2-2 × 2 ADENOSINE MONOPHOSPHATE × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYG_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–622； UniProt 118–739

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4qei
Deposition date deposition_date	2014-05-16
Structure title title	Two distinct conformational states of GlyRS captured in crystal lattice
Keywords keywords	aminoacyl-tRNA synthetase, glycylation, glycyl-tRNA synthetase, tRNA ligase, LIGASE-RNA complex; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4qei__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4qei__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4qei__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	38.09 Å
Rg (electron density)	36.77 Å
Total Rg	37.33 Å
Atom count	11462
Residues	1260
Excluded volume	192040 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4qei__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Glycine--tRNA ligase
Molecular weight formula_weight	71757.7 kDa
EC 编号 ec_number	6.1.1.14
Mutation mutation	E71G, C157R
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5764

IVDRAKMGDTLKRRFFYDQAFAIYGGVSGLYDFGPVGCALKNNIIQTWRQHFIQEEQILEIDCTMLTPEPVLKTSGHVDKFADFMVKDVKNGERFRADHLLKAHLQKLMSDKKCSVEKKSEMESVLAQLDNYGQQELADLFVNYNVKSPITGNDLSPPVSFNLMFKTFIGPGGNMPGYLRPETAQGIFLNFKRLLEFNQGKLPFAAAQIGNSFRNEISPRSGLIRVREFTMAEIEHFVDPSEKDHPKFQNVADLHLYLYSAKAQVSGQSARKMRLGDAVEQGVINNTVLGYFIGRIYLYLTKVGISPDKLRFRQHMENEMAHYACDCWDAESKTSYGWIEIVGCADRSCYDLSCHARATKVPLVAEKPLKEPKTVNVVQFEPSKGAIGKAYKKDAKLVMEYLAICDECYITEMEMLLNEKGEFTIETEGKTFQLTKDMINVKRFQKTLYVEEVVPNVIEPSFGLGRIMYTVFEHTFHVREGDEQRTFFSFPAVVAPFKCSVLPLSQNQEFMPFVKELSEALTRHGVSHKVDDSSGSIGRRYARTDEIGVAFGVTIDFDTVNKTPHTATLRDRDSMRQIRAEISELPSIVQDLANGNITWADVEARYPLFEGQETGKKETIEELEHHHHHH

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	tRNA-Gly-CCC-2-2
Molecular weight formula_weight	22326.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C

GCGCCGCUGGUGUAGUGGUAUCAUGCAAGAUUCCCAUUCUUGCGACCCGGGUUCGAUUCCCGGGCGGCG

Entity 3 Entity 3 non-polymer

Description description	ADENOSINE MONOPHOSPHATE
Molecular weight formula_weight	347.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	33

▼

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

Domain ID domain_id	4qeiA02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	800 — Anticodon-binding domain

▶

Unit-cell length a length_a	134.605 Å
Unit-cell length b length_b	88.446 Å
Unit-cell length c length_c	81.206 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	2.875 Å
Low-resolution limit resolution_low	36.900 Å
R factor r_factor	0.2160
R_work r_work	0.2135
R_free r_free	0.2646

Two distinct conformational states of GlyRS captured in crystal lattice

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glycine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4qei__assembly_1__model_1

4qei__assembly_1__model_1 | I(q)

4qei__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)

Two distinct conformational states of GlyRS captured in crystal lattice

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glycine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4qei__assembly_1__model_1

4qei__assembly_1__model_1 | I(q)

4qei__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)