4x4r

Crystal structure of the A.fulgidus CCA-adding enzyme in complex with a G70A arginyl-tRNA minihelix ending in CCACC and AMPcPP

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-adding enzyme

Archaeoglobus fulgidus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	G70A tRNA minihelix ending in CCACC × 1 DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 1 MAGNESIUM ION × 1 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 1 GLYCEROL × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 2	G70A tRNA minihelix ending in CCACC × 1 ;RNA (5'-D(CPG)-3') ; × 1 DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 1 MAGNESIUM ION × 1 GLYCEROL × 1 D(-)-TARTARIC ACID × 1 DI(HYDROXYETHYL)ETHER × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	CCA_ARCFU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–437； UniProt 1–437 Author chain C； PDBConstruct 1–437； UniProt 1–437

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4x4r
Deposition date deposition_date	2014-12-03
Structure title title	Crystal structure of the A.fulgidus CCA-adding enzyme in complex with a G70A arginyl-tRNA minihelix ending in CCACC and AMPcPP
Keywords keywords	protein-RNA complex, tRNA, non-coding RNA, CCA-adding enzyme, nucleotidyltransferase, ncRNA, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4x4r__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4x4r__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4x4r__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	27.93 Å
Rg (electron density)	27.71 Å
Total Rg	28.29 Å
Atom count	8571
Residues	478
Excluded volume	76972 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4x4r__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4x4r__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Description description	CCA-adding enzyme
Molecular weight formula_weight	53672.5 kDa
EC 编号 ec_number	2.7.7.72
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C
Atom count atom_count	16960

MKVEEILEKALELVIPDEEEVRKGREAEEELRRRLDELGVEYVFVGSYARNTWLKGSLEIDVFLLFPEEFSKEELRERGLEIGKAVLDSYEIRYAEHPYVHGVVKGVEVDVVPCYKLKEPKNIKSAVDRTPFHHKWLEGRIKGKENEVRLLKGFLKANGIYGAEYKVRGFSGYLCELLIVFYGSFLETVKNARRWTRRTVIDVAKGEVRKGEEFFVVDPVDEKRNVAANLSLDNLARFVHLCREFMEAPSLGFFKPKHPLEIEPERLRKIVEERGTAVFAVKFRKPDIVDDNLYPQLERASRKIFEFLERENFMPLRSAFKASEEFCYLLFECQIKEISRVFRRMGPQFEDERNVKKFLSRNRAFRPFIENGRWWAFEMRKFTTPEEGVRSYASTHWHTLGKNVGESIREYFEIISGEKLFKEPVTAELCEMMGVKDSNSSSVDKLAAALEHHHHHH

Source Source

Source organism organism	Archaeoglobus fulgidus
NCBI taxonomy ID ncbi_taxonomy_id	224325
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	G70A tRNA minihelix ending in CCACC
Molecular weight formula_weight	11868.1 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,D

GGCCGCGGCAGGUUCGAGUCCUGCCGCGAUCGCCACC

Entity 3 Entity 3 polymer

Description description	;RNA (5'-D(CPG)-3') ;
Molecular weight formula_weight	605.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	H

Entity 4 Entity 4 non-polymer

Description description	DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER
Molecular weight formula_weight	505.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	2-(N-MORPHOLINO)-ETHANESULFONIC ACID
Molecular weight formula_weight	195.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	GLYCEROL
Molecular weight formula_weight	92.1 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 8 Entity 8 non-polymer

Description description	D(-)-TARTARIC ACID
Molecular weight formula_weight	150.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 9 Entity 9 non-polymer

Description description	DI(HYDROXYETHYL)ETHER
Molecular weight formula_weight	106.1 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	4x4rA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	30 — CCA tRNA nucleotidyltransferase, domain 2

Domain ID domain_id	4x4rA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	10 — Beta Polymerase, domain 2

Domain ID domain_id	4x4rA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	590 — Poly(A) polymerase predicted RNA binding domain

Domain ID domain_id	4x4rA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	1550 — Archaeal tRNA CCA-adding enzyme catalytic domain

Domain ID domain_id	4x4rC01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	30 — CCA tRNA nucleotidyltransferase, domain 2

Domain ID domain_id	4x4rC02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	10 — Beta Polymerase, domain 2

Domain ID domain_id	4x4rC03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	590 — Poly(A) polymerase predicted RNA binding domain

Domain ID domain_id	4x4rC04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	1550 — Archaeal tRNA CCA-adding enzyme catalytic domain

▶

Unit-cell length a length_a	111.100 Å
Unit-cell length b length_b	217.368 Å
Unit-cell length c length_c	58.562 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	3.202 Å
Low-resolution limit resolution_low	29.906 Å
R factor r_factor	0.2116
R_work r_work	0.2087
R_free r_free	0.2664

Crystal structure of the A.fulgidus CCA-adding enzyme in complex with a G70A arginyl-tRNA minihelix ending in CCACC and AMPcPP

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-adding enzyme

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4x4r__assembly_1__model_1

4x4r__assembly_1__model_1 | I(q)

4x4r__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)

Crystal structure of the A.fulgidus CCA-adding enzyme in complex with a G70A arginyl-tRNA minihelix ending in CCACC and AMPcPP

1. Protein Identity and Related Structures Protein Identity & Related Structures

CCA-adding enzyme

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4x4r__assembly_1__model_1

4x4r__assembly_1__model_1 | I(q)

4x4r__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)