SAXSdb — 5c8e

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Light-dependent transcriptional regulator CarH

Thermus thermophilus (strain HB27 / ATCC BAA-163 / DSM 7039)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 2	26-mer DNA segment containing the CarH operator sequence (antisense strand) × 1 26-mer DNA segment containing the CarH operator sequence (sense strand) × 1 COBALAMIN × 4 5'-DEOXYADENOSINE × 4	Consistent with all polymers
2	Protein–DNA	Homooligomer	Protein 4 DNA 2	26-mer DNA segment containing the CarH operator sequence (antisense strand) × 1 26-mer DNA segment containing the CarH operator sequence (sense strand) × 1 COBALAMIN × 4 5'-DEOXYADENOSINE × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q746J7_THET2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 21–305； UniProt 1–285 Author chain B； PDBConstruct 21–305； UniProt 1–285 Author chain C； PDBConstruct 21–305； UniProt 1–285 Author chain D； PDBConstruct 21–305； UniProt 1–285 Author chain E； PDBConstruct 21–305； UniProt 1–285 Author chain F； PDBConstruct 21–305； UniProt 1–285 Author chain G； PDBConstruct 21–305； UniProt 1–285 Author chain H； PDBConstruct 21–305； UniProt 1–285

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5c8e
Deposition date deposition_date	2015-06-25
Structure title title	Crystal structure of Thermus thermophilus CarH bound to adenosylcobalamin and a 26-bp DNA segment
Keywords keywords	Transcription factor, light sensor, adenosylcobalamin-binding, DNA-binding, Transcription regulator-DNA complex; Transcription regulator/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5c8e__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5c8e__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5c8e__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	35.31 Å
Rg (electron density)	33.52 Å
Total Rg	34.20 Å
Atom count	8789
Residues	1085
Excluded volume	153100 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5c8e__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`5c8e__assembly_2__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Light-dependent transcriptional regulator CarH
Molecular weight formula_weight	33323.2 kDa
Source method src_method	man
Copy count entity_count	8

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F,G,H
Atom count atom_count	17492

MGSSHHHHHHSSGLVPRGSHMTSSGVYTIAEVEAMTGLSAEVLRQWERRYGFPKPRRTPGGHRLYSAEDVEALKTIKRWLEEGATPKAAIRRYLAQEVRPEDLGTGLLEALLRGDLAGAEALFRRGLRFWGPEGVLEHLLLPVLREVGEAWHRGEIGVAEEHLASTFLRARLQELLDLAGFPPGPPVLVTTPPGERHEIGAMLAAYHLRRKGVPALYLGPDTPLPDLRALARRLGAGAVVLSAVLSEPLRALPDGALKDLAPRVFLGGQGAGPEEARRLGAEYMEDLKGLAEALWLPRGPEKEAI

Source Source

Source organism organism	Thermus thermophilus (strain HB27 / ATCC BAA-163 / DSM 7039)
NCBI taxonomy ID ncbi_taxonomy_id	262724
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	26-mer DNA segment containing the CarH operator sequence (antisense strand)
Molecular weight formula_weight	7998.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I,K

ATAGGTTTTGTCAAGCTTTTGTACAT

Entity 3 Entity 3 polymer

Description description	26-mer DNA segment containing the CarH operator sequence (sense strand)
Molecular weight formula_weight	7972.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	J,L

ATGTACAAAAGCTTGACAAAACCTAT

Entity 4 Entity 4 non-polymer

Description description	COBALAMIN
Molecular weight formula_weight	1330.4 kDa
Source method src_method	syn
Copy count entity_count	8

Entity 5 Entity 5 non-polymer

Description description	5'-DEOXYADENOSINE
Molecular weight formula_weight	251.2 kDa
Source method src_method	syn
Copy count entity_count	8

▼

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

Domain ID domain_id	5c8eB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1660 — Multidrug-efflux Transporter Regulator; Chain: A; Domain 2
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	5c8eB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1240 — Methyltransferase, Methionine Synthase (B12-binding Domains); Chain A, domain 1
Homologous superfamily homologous superfamily	10 — Methionine synthase domain

Domain ID domain_id	5c8eB03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	280 — Cobalamin-binding domain

Domain ID domain_id	5c8eC01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	280 — Cobalamin-binding domain

Domain ID domain_id	5c8eG01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1660 — Multidrug-efflux Transporter Regulator; Chain: A; Domain 2
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	5c8eG02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1240 — Methyltransferase, Methionine Synthase (B12-binding Domains); Chain A, domain 1
Homologous superfamily homologous superfamily	10 — Methionine synthase domain

Domain ID domain_id	5c8eG03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	280 — Cobalamin-binding domain

▶

Unit-cell length a length_a	177.940 Å
Unit-cell length b length_b	141.820 Å
Unit-cell length c length_c	162.690 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	32

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	3.890 Å
Low-resolution limit resolution_low	91.638 Å
R factor r_factor	0.2505
R_work r_work	0.2502
R_free r_free	0.2573

Crystal structure of Thermus thermophilus CarH bound to adenosylcobalamin and a 26-bp DNA segment

1. Protein Identity and Related Structures Protein Identity & Related Structures

Light-dependent transcriptional regulator CarH

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5c8e__assembly_1__model_1

5c8e__assembly_1__model_1 | I(q)

5c8e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

7. Citations (1)

Crystal structure of Thermus thermophilus CarH bound to adenosylcobalamin and a 26-bp DNA segment

1. Protein Identity and Related Structures Protein Identity & Related Structures

Light-dependent transcriptional regulator CarH

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5c8e__assembly_1__model_1

5c8e__assembly_1__model_1 | I(q)

5c8e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

7. Citations (1)