SAXSdb — 5dea

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Fragile X mental retardation protein 1

OrganismNot specified

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	sc1 × 1 POTASSIUM ION × 2 CESIUM ION × 1 water × 1	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	sc1 × 1 POTASSIUM ION × 2 CESIUM ION × 2 water × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	FMR1_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–18； UniProt 527–544 Author chain D； PDBConstruct 1–18； UniProt 527–544

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5dea
Deposition date deposition_date	2015-08-25
Structure title title	Crystal structure of the complex between human FMRP RGG motif and G-quadruplex RNA, cesium bound form.
Keywords keywords	Fragile X syndrome, RNA structure, RGG box, FMRP, G-quadruplex, RNA binding protein-RNA complex; RNA binding protein/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5dea__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5dea__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5dea__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	13.99 Å
Rg (electron density)	13.29 Å
Total Rg	14.00 Å
Atom count	849
Residues	49
Excluded volume	12562 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5dea__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`5dea__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	sc1
Molecular weight formula_weight	11459.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	A,C
Atom count atom_count	1703

GCUGCGGUGUGGAAGGAGUGGCUGGGUUGCGCAGC

Entity 2 Entity 2 polymer

Description description	Fragile X mental retardation protein 1
Molecular weight formula_weight	1788.9 kDa
Mutation mutation	R527A
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,D

ARGDGRRRGGGGRGQGGR

Entity 3 Entity 3 non-polymer

Description description	POTASSIUM ION
Molecular weight formula_weight	39.1 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 4 Entity 4 non-polymer

Description description	CESIUM ION
Molecular weight formula_weight	132.9 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	8

▶

Unit-cell length a length_a	56.570 Å
Unit-cell length b length_b	129.870 Å
Unit-cell length c length_c	36.790 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	2.797 Å
Low-resolution limit resolution_low	19.867 Å
R factor r_factor	0.2027
R_work r_work	0.2015
R_free r_free	0.2256

Crystal structure of the complex between human FMRP RGG motif and G-quadruplex RNA, cesium bound form.

1. Protein Identity and Related Structures Protein Identity & Related Structures

Fragile X mental retardation protein 1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5dea__assembly_2__model_1

5dea__assembly_2__model_1 | I(q)

5dea__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Citations (1)

Crystal structure of the complex between human FMRP RGG motif and G-quadruplex RNA, cesium bound form.

1. Protein Identity and Related Structures Protein Identity & Related Structures

Fragile X mental retardation protein 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5dea__assembly_2__model_1

5dea__assembly_2__model_1 | I(q)

5dea__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Citations (1)