SAXSdb — 5h58

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CprB

Streptomyces coelicolor A3(2)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 2	;DNA (5'-D(APGPGPCAPGPGPCPGPGPCPAPCPGPGPTPCPTPGPTPTPGPAPGPTPTPC)-3') ; × 1 ;DNA (5'-D(GPAPACPTPCPAPAPCPAPGPAPCPCPGPTPGPCPCPGPCPCPTPGPCPCPT)-3') ; × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	O66122_STRCH
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–215； UniProt 1–215 Author chain B； PDBConstruct 1–215； UniProt 1–215 Author chain C； PDBConstruct 1–215； UniProt 1–215 Author chain D； PDBConstruct 1–215； UniProt 1–215

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5h58
Deposition date deposition_date	2016-11-04
Structure title title	Structural and dynamics studies of the TetR family protein, CprB from Streptomyces coelicolor in complex with its biological operator sequence
Keywords keywords	;TetR-FTR, CprB-DNA complex, quorum sensing, N-terminal, Streptomyces coelicolor, gamma-butyrolactone receptors, TRANSCRIPTION-DNA complex ;; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5h58__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5h58__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5h58__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	38.34 Å
Rg (electron density)	39.29 Å
Total Rg	39.45 Å
Atom count	6885
Residues	833
Excluded volume	119240 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5h58__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	CprB
Molecular weight formula_weight	23719.3 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	6885

MARQLRAEQTRATIIGAAADLFDRRGYESTTLSEIVAHAGVTKGALYFHFAAKEDLAHAILEIQSRTSRRLAKDLDGRGYSSLEALMRLTFGMARLCVQGPVLRAGLRLATAGVPVRPPLPHPFTEWREIATSRLLDAVRQSDVHQDIDVDSVAHTLVCSVVGTRVVGGTLEPAGREPRRLAEMWYILIRGMVPVTRRARYVTLAARLEQETGTA

Source Source

Source organism organism	Streptomyces coelicolor A3(2)
NCBI taxonomy ID ncbi_taxonomy_id	100226
Host organism host_organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(APGPGPCAPGPGPCPGPGPCPAPCPGPGPTPCPTPGPTPTPGPAPGPTPTP*C)-3') ;
Molecular weight formula_weight	8389.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

AGGCAGGCGGCACGGTCTGTTGAGTTC

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(GPAPACPTPCPAPAPCPAPGPAPCPCPGPTPGPCPCPGPCPCPTPGPCPCP*T)-3') ;
Molecular weight formula_weight	8207.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

GAACTCAACAGACCGTGCCGCCTGCCT

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	5h58A00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	357 — Tetracycline Repressor; domain 2
Homologous superfamily homologous superfamily	10 — Tetracycline Repressor, domain 2

Domain ID domain_id	5h58B00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	357 — Tetracycline Repressor; domain 2
Homologous superfamily homologous superfamily	10 — Tetracycline Repressor, domain 2

Domain ID domain_id	5h58C00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	357 — Tetracycline Repressor; domain 2
Homologous superfamily homologous superfamily	10 — Tetracycline Repressor, domain 2

Domain ID domain_id	5h58D00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	357 — Tetracycline Repressor; domain 2
Homologous superfamily homologous superfamily	10 — Tetracycline Repressor, domain 2

▶

Unit-cell length a length_a	149.810 Å
Unit-cell length b length_b	149.810 Å
Unit-cell length c length_c	70.460 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 32
Space-group number int_tables_number	145
Crystal system crystal_system	—

Resolution resolution	3.991 Å
Low-resolution limit resolution_low	40.249 Å
R factor r_factor	0.2215
R_work r_work	0.2166
R_free r_free	0.2816

Structural and dynamics studies of the TetR family protein, CprB from Streptomyces coelicolor in complex with its biological operator sequence

1. Protein Identity and Related Structures Protein Identity & Related Structures

CprB

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5h58__assembly_1__model_1

5h58__assembly_1__model_1 | I(q)

5h58__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Structural and dynamics studies of the TetR family protein, CprB from Streptomyces coelicolor in complex with its biological operator sequence

1. Protein Identity and Related Structures Protein Identity & Related Structures

CprB

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5h58__assembly_1__model_1

5h58__assembly_1__model_1 | I(q)

5h58__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)