SAXSdb — 5on2

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucine--tRNA ligase

Escherichia coli (strain K12)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA(leu) × 1 ZINC ION × 1 5'-O-(L-leucylsulfamoyl)adenosine × 1 2'-(L-NORVALYL)AMINO-2'-DEOXYADENOSINE × 1 MAGNESIUM ION × 1	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA(leu) × 1 ZINC ION × 1 5'-O-(L-leucylsulfamoyl)adenosine × 1 2'-(L-NORVALYL)AMINO-2'-DEOXYADENOSINE × 1 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYL_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 21–880； UniProt 1–860 Author chain D； PDBConstruct 21–880； UniProt 1–860

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5on2
Deposition date deposition_date	2017-08-02
Structure title title	Quaternary complex of mutant T252A of E. coli leucyl-tRNA synthetase with tRNA(leu), leucyl-adenylate analogue, and post-transfer editing analogue of norvaline in the aminoacylation conformation
Keywords keywords	;reaction catalysed: ATP + L-leucine + tRNA(Leu) = AMP + diphosphate + L-leucyl-tRNA(Leu) protein translation, aminoacyl-tRNA activity, leucine-tRNA ligase, class Ia, TRANSLATION ;; TRANSLATION
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5on2__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5on2__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5on2__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	33.49 Å
Rg (electron density)	33.33 Å
Total Rg	33.79 Å
Atom count	8611
Residues	941
Excluded volume	146630 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5on2__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`5on2__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Leucine--tRNA ligase
Molecular weight formula_weight	99486.0 kDa
EC 编号 ec_number	6.1.1.4
Mutation mutation	T252A
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,D
Atom count atom_count	17332

MGSSHHHHHHSSGLVPRGSHMQEQYRPEEIESKVQLHWDEKRTFEVTEDESKEKYYCLSMLPYPSGRLHMGHVRNYTIGDVIARYQRMLGKNVLQPIGWDAFGLPAEGAAVKNNTAPAPWTYDNIAYMKNQLKMLGFGYDWSRELATCTPEYYRWEQKFFTELYKKGLVYKKTSAVNWCPNDQTVLANEQVIDGCCWRCDTKVERKEIPQWFIKITAYADELLNDLDKLDHWPDTVKTMQRNWIGRSEGVEITFNVNDYDNTLTVYTTRPDAFMGCTYLAVAAGHPLAQKAAENNPELAAFIDECRNTKVAEAEMATMEKKGVDTGFKAVHPLTGEEIPVWAANFVLMEYGTGAVMAVPGHDQRDYEFASKYGLNIKPVILAADGSEPDLSQQALTEKGVLFNSGEFNGLDHEAAFNAIADKLTAMGVGERKVNYRLRDWGVSRQRYWGAPIPMVTLEDGTVMPTPDDQLPVILPEDVVMDGITSPIKADPEWAKTTVNGMPALRETDTFDTFMESSWYYARYTCPQYKEGMLDSEAANYWLPVDIYIGGIEHAIMHLLYFRFFHKLMRDAGMVNSDEPAKQLLCQGMVLADAFYYVGENGERNWVSPVDAIVERDEKGRIVKAKDAAGHELVYTGMSKMSKSKNNGIDPQVMVERYGADTVRLFMMFASPADMTLEWQESGVEGANRFLKRVWKLVYEHTAKGDVAALNVDALTENQKALRRDVHKTIAKVTDDIGRRQTFNTAIAAIMELMNKLAKAPTDGEQDRALMQEALLAVVRMLNPFTPHICFTLWQELKGEGDIDNAPWPVADEKAMVEDSTLVVVQVNGKVRAKITVPVDATEEQVRERAGQEHLVAKYLDGVTVRKVIYVPGKLLNLVVG

Source Source

Source organism organism	Escherichia coli (strain K12)
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli BL21

Entity 2 Entity 2 polymer

Description description	tRNA(leu)
Molecular weight formula_weight	28052.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,E

GCCCGGAUGGUGGAAUCGGUAGACACAAGGGAUUUAAAAUCCCUCGGCGUUCGCGCUGUGCGGGUUCAAGUCCCGCUCCGGGUACCA

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	5'-O-(L-leucylsulfamoyl)adenosine
Molecular weight formula_weight	459.5 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	2'-(L-NORVALYL)AMINO-2'-DEOXYADENOSINE
Molecular weight formula_weight	365.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

▶

Unit-cell length a length_a	159.650 Å
Unit-cell length b length_b	70.620 Å
Unit-cell length c length_c	230.340 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	104.52 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	0.2276
R_work r_work	0.2258
R_free r_free	0.2632

Quaternary complex of mutant T252A of E. coli leucyl-tRNA synthetase with tRNA(leu), leucyl-adenylate analogue, and post-transfer editing analogue of norvaline in the aminoacylation conformation

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5on2__assembly_2__model_1

5on2__assembly_2__model_1 | I(q)

5on2__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)

Quaternary complex of mutant T252A of E. coli leucyl-tRNA synthetase with tRNA(leu), leucyl-adenylate analogue, and post-transfer editing analogue of norvaline in the aminoacylation conformation

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5on2__assembly_2__model_1

5on2__assembly_2__model_1 | I(q)

5on2__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)