SAXSdb — 6aax

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Dimethyladenosine transferase 1, mitochondrial

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 28–346	Not recorded	RNA (28-mer) × 1 SAM S-ADENOSYLMETHIONINE × 1 PEG DI(HYDROXYETHYL)ETHER × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 7；293 K；0.2M potassium chloride, 0.025M magnesium sulfate hydrate, 0.05M HEPES sodium, pH 7.0, 20% v/v polyethylene glycol 200	Resolution 2.99 Å R-free 0.271
2	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain C； UniProt 28–346	Not recorded	RNA (28-mer) × 1 SAM S-ADENOSYLMETHIONINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 7；293 K；0.2M potassium chloride, 0.025M magnesium sulfate hydrate, 0.05M HEPES sodium, pH 7.0, 20% v/v polyethylene glycol 200	Resolution 2.99 Å R-free 0.271

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 6AAX	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
6AJK Crystal structure of TFB1M and h45 in homo sapiens Deposited 2018-08-28	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 28–346（319 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5；293 K；0.1M sodium citrate, pH 5.0, 20% PEG 8000	Resolution 3.00 Å R-free 0.241
8CSP Human mitochondrial small subunit assembly intermediate (State A) Deposited 2022-05-13	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 32 PDB declaration: 33-meric	Chain 5 1–346（346 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1 SAM S-ADENOSYLMETHIONINE × 1 K POTASSIUM ION × 4 MG MAGNESIUM ION × 28 FES FE2/S2 (INORGANIC) CLUSTER × 2 ZN ZINC ION × 1 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.66 Å
8CSQ Human mitochondrial small subunit assembly intermediate (State B) Deposited 2022-05-13	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 32 PDB declaration: 33-meric	Chain 5 1–346（346 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1 SAM S-ADENOSYLMETHIONINE × 1 K POTASSIUM ION × 4 MG MAGNESIUM ION × 27 ZN ZINC ION × 1 FES FE2/S2 (INORGANIC) CLUSTER × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.54 Å
8CSR Human mitochondrial small subunit assembly intermediate (State C) Deposited 2022-05-13	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 33 PDB declaration: 34-meric	Chain 5 1–346（346 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1 SAM S-ADENOSYLMETHIONINE × 1 K POTASSIUM ION × 5 MG MAGNESIUM ION × 31 NAD NICOTINAMIDE-ADENINE-DINUCLEOTIDE × 1 ZN ZINC ION × 1 FES FE2/S2 (INORGANIC) CLUSTER × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.54 Å
8CSU Human mitochondrial small subunit assembly intermediate (State C*) Deposited 2022-05-13	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 32 PDB declaration: 33-meric	Chain 5 1–346（346 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1 SAM S-ADENOSYLMETHIONINE × 1 K POTASSIUM ION × 5 MG MAGNESIUM ION × 26 NAD NICOTINAMIDE-ADENINE-DINUCLEOTIDE × 1 ZN ZINC ION × 1 FES FE2/S2 (INORGANIC) CLUSTER × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.03 Å
9G5B Assembly intermediate of human mitochondrial ribosome small subunit (State A) Deposited 2024-07-16	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 31 PDB declaration: 32-meric	Chain c 1–346（346 aa）	Not recorded	MG MAGNESIUM ION × 12 ZN ZINC ION × 1 FES FE2/S2 (INORGANIC) CLUSTER × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4；20mM HEPES-HCl, 100mM KCl, 20mM MgCl2, 0.02% DDM, 1mM PMSF, 1x protease-inhibitor mix, 0.5mM GMP-PNP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
9H55 Assembly intermediate of human mitochondrial ribosome small subunit in complex with NOA1 and TFB1M (state N3) Deposited 2024-10-22	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 31 PDB declaration: 32-meric	Chain 5 1–346（346 aa）	Not recorded	MG MAGNESIUM ION × 41 K POTASSIUM ION × 10 ZN ZINC ION × 1 FES FE2/S2 (INORGANIC) CLUSTER × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å

7 other PDB entries and 7 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	TFB1M_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–319； UniProt 28–346 Author chain C； PDBConstruct 1–319； UniProt 28–346

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	6aax
Deposition date deposition_date	2018-07-19
Structure title title	Crystal structure of TFB1M and h45 with SAM in homo sapiens
Keywords keywords	TFB1M, h45, TRANSFERASE-RNA complex; TRANSFERASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	36.16 Å
Radius of gyration Rg (electron density) rg_electron	35.50 Å
Forward intensity I(0) i0	138466000.00
Molecular weight molecular_weight	82496.0 kDa
Excluded volume excluded_volume	98071 Å³
Envelope volume envelope_volume	133550 Å³
Hydration-shell volume shell_volume	33890 Å³
Envelope diameter envelope_diameter	127.7 Å
Shell Rg shell_rg	38.44 Å
Envelope Rg envelope_rg	35.49 Å
Shape Rg shape_rg	35.46 Å
Total Rg total_rg	35.80 Å
Total atoms total_atoms	5735
Residues n_residues	638
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	118.4 Å
Rg (real space) rg_real	36.37 Å
Rg uncertainty (real space) rg_real_error	1.18 Å
I(0) (real space) i0_real	1.3850e+08
I(0) uncertainty (real space) i0_real_error	2.5900e+06
Rg (reciprocal space) rg_reciprocal	36.25 Å
I(0) (reciprocal space) i0_reciprocal	138400000.0000
Solution quality estimate total_estimate	0.8723
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	115.7 Å
Skewness Skewness skewness	0.390
Kurtosis Kurtosis kurtosis	-0.494
Angular range angular_range	— – 0.2200 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	7265000.0000
Real-space data points n_real_points	45
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.913; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.861; Smooth: 0.734

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Dimethyladenosine transferase 1, mitochondrial
Molecular weight formula_weight	36622.2 kDa
EC 编号 ec_number	2.1.1.-
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C
Atom count atom_count	5735

QAAKQLSQNFLLDLRLTDKIVRKAGNLTNAYVYEVGPGPGGITRSILNADVAELLVVEKDTRFIPGLQMLSDAAPGKLRIVHGDVLTFKVEKAFSESLKRPWEDDPPNVHIIGNLPFSVSTPLIIKWLENISCRDGPFVYGRTQMTLTFQKEVAERLAANTGSKQRSRLSVMAQYLCNVRHIFTIPGQAFVPKPEVDVGVVHFTPLIQPKIEQPFKLVEKVVQNVFQFRRKYCHRGLRMLFPEAQRLESTGRLLELADIDPTLRPRQLSISHFKSLCDVYRKMCDEDPQLFAYNFREELKRRKSKNEEKEEDDAENYRL

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	Human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RNA (28-mer)
Molecular weight formula_weight	9035.4 kDa
Source method src_method	nat
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,D

GGUAAGUGUACUGGAAAGUGCACUUGCC

Entity 3 Entity 3 non-polymer

Description description	S-ADENOSYLMETHIONINE
Molecular weight formula_weight	398.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	DI(HYDROXYETHYL)ETHER
Molecular weight formula_weight	106.1 kDa
Source method src_method	syn
Copy count entity_count	1

▼

7. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	6aaxA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	150 — Vaccinia Virus protein VP39

Domain ID domain_id	6aaxA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	8 — Helicase, Ruva Protein; domain 3
Homologous superfamily homologous superfamily	100 — rRNA adenine dimethylase, C-terminal domain

Domain ID domain_id	6aaxC01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	150 — Vaccinia Virus protein VP39

Domain ID domain_id	6aaxC02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	8 — Helicase, Ruva Protein; domain 3
Homologous superfamily homologous superfamily	100 — rRNA adenine dimethylase, C-terminal domain

▶

8. Citations (1)

▶

Unit-cell length a length_a	104.120 Å
Unit-cell length b length_b	104.120 Å
Unit-cell length c length_c	449.378 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	24

Space group space_group	P 61 2 2
Space-group number int_tables_number	178
Crystal system crystal_system	—

Resolution resolution	2.994 Å
Low-resolution limit resolution_low	38.627 Å
R factor r_factor	0.2245
R_work r_work	0.2222
R_free r_free	0.2706

fit	/app/data/saxs_computation/aa/6aax/6aax.fit
pddf	/app/data/pr_computation/aa/6aax/6aax.pr.out
profile	/app/data/saxs_computation/aa/6aax/6aax.dat

Crystal structure of TFB1M and h45 with SAM in homo sapiens

1. Protein Identity and Related Structures Protein Identity & Related Structures

Dimethyladenosine transferase 1, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

7. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)