SAXSdb — 6v0v

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

V(D)J recombination-activating protein 1

Mus musculus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	V(D)J recombination-activating protein 2 × 1 （P21784） DNA (30-MER) × 1 DNA (30-MER) × 1 CALCIUM ION × 2 ZINC ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RAG1_MOUSE
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–775； UniProt 265–1039

V(D)J recombination-activating protein 2

Mus musculus

UniProt P21784

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	V(D)J recombination-activating protein 1 × 1 （P15919） DNA (30-MER) × 1 DNA (30-MER) × 1 CALCIUM ION × 2 ZINC ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RAG2_MOUSE
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–520； UniProt 1–520

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	6v0v
Deposition date deposition_date	2019-11-19
Structure title title	Cryo-EM structure of mouse WT RAG1/2 NFC complex (DNA0)
Keywords keywords	V(D)J recombination, RAG, SCID, RECOMBINATION, RECOMBINATION-DNA complex; RECOMBINATION/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

6v0v__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

6v0v__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

6v0v__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	33.85 Å
Rg (electron density)	32.85 Å
Total Rg	33.47 Å
Atom count	8192
Residues	947
Excluded volume	141820 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`6v0v__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	V(D)J recombination-activating protein 1
Molecular weight formula_weight	88524.6 kDa
EC 编号 ec_number	3.1.-.-,2.3.2.27
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	8192

NCSKIHLSTKLLAVDFPAHFVKSISCQICEHILADPVETSCKHLFCRICILRCLKVMGSYCPSCRYPCFPTDLESPVKSFLNILNSLMVKCPAQDCNEEVSLEKYNHHVSSHKESKETLVHINKGGRPRQHLLSLTRRAQKHRLRELKIQVKEFADKEEGGDVKAVCLTLFLLALRARNEHRQADELEAIMQGRGSGLQPAVCLAIRVNTFLSCSQYHKMYRTVKAITGRQIFQPLHALRNAEKVLLPGYHPFEWQPPLKNVSSRTDVGIIDGLSGLASSVDEYPVDTIAKRFRYDSALVSALMDMEEDILEGMRSQDLDDYLNGPFTVVVKESCDGMGDVSEKHGSGPAVPEKAVRFSFTVMRITIEHGSQNVKVFEEPKPNSELCCKPLCLMLADESDHETLTAILSPLIAEREAMKSSELTLEMGGIPRTFKFIFRGTGYDEKLVREVEGLEASGSVYICTLCDTTRLEASQNLVFHSITRSHAENLQRYEVWRSNPYHESVEELRDRVKGVSAKPFIETVPSIDALHCDIGNAAEFYKIFQLEIGEVYKHPNASKEERKRWQATLDKHLRKRMNLKPIMRMNGNFARKLMTQETVDAVCELIPSEERHEALRELMDLYLKMKPVWRSSCPAKECPESLCQYSFNSQRFAELLSTKFKYRYEGKITNYFHKTLAHVPEIIERDGSIGAWASEGNESGNKLFRRFRKMNARQSKCYEMEDVLKHHWLYTSKYLQKFMNAHNALKSSGFTMNSKETLGDPLGIEDSLESQDSME

Source Source

Source organism organism	Mus musculus
Common name common_name	Mouse
NCBI taxonomy ID ncbi_taxonomy_id	10090
Host organism host_organism	Homo sapiens

Entity 2 Entity 2 polymer

Description description	V(D)J recombination-activating protein 2
Molecular weight formula_weight	58158.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MSLQMVTVGHNIALIQPGFSLMNFDGQVFFFGQKGWPKRSCPTGVFHFDIKQNHLKLKPAIFSKDSCYLPPLRYPATCSYKGSIDSDKHQYIIHGGKTPNNELSDKIYIMSVACKNNKKVTFRCTEKDLVGDVPEPRYGHSIDVVYSRGKSMGVLFGGRSYMPSTQRTTEKWNSVADCLPHVFLIDFEFGCATSYILPELQDGLSFHVSIARNDTVYILGGHSLASNIRPANLYRIRVDLPLGTPAVNCTVLPGGISVSSAILTQTNNDEFVIVGGYQLENQKRMVCSLVSLGDNTIEISEMETPDWTSDIKHSKIWFGSNMGNGTIFLGIPGDNKQAMSEAFYFYTLRCSEEDLSEDQKIVSNSQTSTEDPGDSTPFEDSEEFCFSAEATSFDGDDEFDTYNEDDEDDESVTGYWITCCPTCDVDINTWVPFYSTELNKPAMIYCSHGDGHWVHAQCMDLEERTLIHLSEGSNKYYCNEHVQIARALQAPKRNPPLQKPPMKSLHKKGSGKVLTPAKKS

Source Source

Source organism organism	Mus musculus
Common name common_name	Mouse
NCBI taxonomy ID ncbi_taxonomy_id	10090
Host organism host_organism	Homo sapiens

Entity 3 Entity 3 polymer

Description description	DNA (30-MER)
Molecular weight formula_weight	14268.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

CGGGTTTTTGTTAAGGGCTGTATCACTGTGTAAGACAGGCCAGATC

Entity 4 Entity 4 polymer

Description description	DNA (30-MER)
Molecular weight formula_weight	14064.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I

GATCTGGCCTGTCTTACACAGTGATACAGCCCTTAACAAAAACCCG

Entity 5 Entity 5 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.61 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	111362

Cryo-EM structure of mouse WT RAG1/2 NFC complex (DNA0)

1. Protein Identity and Related Structures Protein Identity & Related Structures

V(D)J recombination-activating protein 1

State in the Current Structure

Other States of the Same Protein in the Database

V(D)J recombination-activating protein 2

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6v0v__assembly_1__model_1

6v0v__assembly_1__model_1 | I(q)

6v0v__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)

Cryo-EM structure of mouse WT RAG1/2 NFC complex (DNA0)

1. Protein Identity and Related Structures Protein Identity & Related Structures

V(D)J recombination-activating protein 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

V(D)J recombination-activating protein 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6v0v__assembly_1__model_1

6v0v__assembly_1__model_1 | I(q)

6v0v__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)