SAXSdb — 7da7

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Toll-like receptor 3

Mus musculus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 1	RNA component of mitochondrial RNAase P (Rmrp), RNase MRP RNA × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TLR3_MOUSE
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 14–684； UniProt 28–698 Author chain B； PDBConstruct 14–684； UniProt 28–698

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7da7
Deposition date deposition_date	2020-10-15
Structure title title	Mouse Toll-like receptor 3 ectodomain in complex with lncRNA Rmrp in elongated form
Keywords keywords	complex, innate immune system, RNA BINDING PROTEIN, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7da7__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7da7__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7da7__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	46.57 Å
Rg (electron density)	47.26 Å
Total Rg	47.12 Å
Atom count	11825
Residues	1428
Excluded volume	209160 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7da7__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Description description	Toll-like receptor 3
Molecular weight formula_weight	78101.6 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	11825

HHHHHHENLYFQSQCTVRYNVADCSHLKLTHIPDDLPSNITVLNLTHNQLRRLPPTNFTRYSQLAILDAGFNSISKLEPELCQILPLLKVLNLQHNELSQISDQTFVFCTNLTELDLMSNSIHKIKSNPFKNQKNLIKLDLSHNGLSSTKLGTGVQLENLQELLLAKNKILALRSEELEFLGNSSLRKLDLSSNPLKEFSPGCFQTIGKLFALLLNNAQLNPHLTEKLCWELSNTSIQNLSLANNQLLATSESTFSGLKWTNLTQLDLSYNNLHDVGNGSFSYLPSLRYLSLEYNNIQRLSPRSFYGLSNLRYLSLKRAFTKQSVSLASHPNIDDFSFQWLKYLEYLNMDDNNIPSTKSNTFTGLVSLKYLSLSKTFTSLQTLTNETFVSLAHSPLLTLNLTKNHISKIANGTFSWLGQLRILDLGLNEIEQKLSGQEWRGLRNIFEIYLSYNKYLQLSTSSFALVPSLQRLMLRRVALKNVDISPSPFRPLRNLTILDLSNNNIANINEDLLEGLENLEILDFQHNNLARLWKRANPGGPVNFLKGLSHLHILNLESNGLDEIPVGVFKNLFELKSINLGLNNLNKLEPFIFDDQTSLRSLNLQKNLITSVEKDVFGPPFQNLNSLDMRFNPFDCTCESISWFVNWINQTHTNISELSTHYLCNTPHHYYGFPLKLFDTSSCK

Source Source

Source organism organism	Mus musculus
Common name common_name	Mouse
NCBI taxonomy ID ncbi_taxonomy_id	10090
Host organism host_organism	Trichoplusia ni

Entity 2 Entity 2 polymer

Description description	RNA component of mitochondrial RNAase P (Rmrp), RNase MRP RNA
Molecular weight formula_weight	48124.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C

GCUCGCUCUGAAGGCCUGUUUCCUAGGCUACAUACGAGGGACAUGUUCCUUAUCCUUUCGCCUAGGGGAAAGUCCCCGGAAGCUCACAUAGUGACGCAGGCAGUGCGACCUGGCUCGCACCAACCACACGGGGCUCAUUCUCAGCGCGGC

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.47 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	108128

Mouse Toll-like receptor 3 ectodomain in complex with lncRNA Rmrp in elongated form

1. Protein Identity and Related Structures Protein Identity & Related Structures

Toll-like receptor 3

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7da7__assembly_1__model_1

7da7__assembly_1__model_1 | I(q)

7da7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

7. Citations (1)

Mouse Toll-like receptor 3 ectodomain in complex with lncRNA Rmrp in elongated form

1. Protein Identity and Related Structures Protein Identity & Related Structures

Toll-like receptor 3

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7da7__assembly_1__model_1

7da7__assembly_1__model_1 | I(q)

7da7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

7. Citations (1)