SAXSdb — 7yhq

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Sex-determining region Y protein,DNA glycosylase/AP lyase ROS1

Arabidopsis thaliana

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 2	DNA (40-MER) × 1 DNA (40-MER) × 1 IRON/SULFUR CLUSTER × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SRY_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–76； UniProt 56–130

Sex-determining region Y protein,DNA glycosylase/AP lyase ROS1

Arabidopsis thaliana

UniProt Q9SJQ6

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 2	DNA (40-MER) × 1 DNA (40-MER) × 1 IRON/SULFUR CLUSTER × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ROS1_ARATH
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 82–235； UniProt 511–664 Author chain A； PDBConstruct 236–473； UniProt 836–1073 Author chain A； PDBConstruct 474–757； UniProt 1110–1393

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7yhq
Deposition date deposition_date	2022-07-14
Structure title title	CryoEM structure of Arabidopsis ROS1 in complex with a covalent-linked reaction intermediate at 3.9 Angstroms resolution
Keywords keywords	ROS1, DNA glycosylase, DNA demethylation, DNA BINDING PROTEIN, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7yhq__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7yhq__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7yhq__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	26.02 Å
Rg (electron density)	24.75 Å
Total Rg	25.53 Å
Atom count	4065
Residues	435
Excluded volume	69905 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7yhq__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Sex-determining region Y protein,DNA glycosylase/AP lyase ROS1
Molecular weight formula_weight	86261.8 kDa
EC 编号 ec_number	4.2.99.18
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	4065

SVQDRVKRPMNAFIVWSRDQRRKMALENPRMRNSEISKQLGYQWKMLTEAEKWPFFQEAQKLQAMHREKYPNYKYRKGGSSAGAIVPVTPVKKPRPRPKVDLDDETDRVWKLLLENINSEGVDGSDEQKAKWWEEERNVFRGRADSFIARMHLVQGDRRFTPWKGSVVDSVVGVFLTQNVSDHLSSSAFMSLASQFPVPFVPSSNFDAGTSSMPSIQITYLDSEETMSSPPDHNHSCQKPTLKEKGKKVLKEEKKAFDWDCLRREAQARAGIREKTRSTMDTVDWKAIRAADVKEVAETIKSRGMNHKLAERIQGFLDRLVNDHGSIDLEWLRDVPPDKAKEYLLSFNGLGLKSVECVRLLTLHHLAFPVDTNVGRIAVRLGWVPLQPLPESLQLHLLEMYPMLESIQKYLWPRLCKLDQKTLYELHYQMITFGKVFCTKSKPNCNACPMKGECRHFASAFASARLALPSTEKTCCEPIIEEPASPEPETAEVSIADIEEAFFEDPEEIPTIRLNMDAFTSNLKKIMEHNKELQDGNMSSALVALTAETASLPMPKLKNISQLRTEHRVYELPDEHPLLAQLEKREPDDPCSYLLAIWTPGETADSIQPSVSTCIFQANGMLCDEETCFSCNSIKETRSQIVRGTILIPCRTAMRGSFPLNGTYFQVNEVFADHASSLNPINVPRELIWELPRRTVYFGTSVPTIFKGLSTEKIQACFWKGYVCVRGFDRKTRGPKPLIARLHFPASKLKGQQANLA

Source Source

Source organism organism	Arabidopsis thaliana
Common name common_name	thale cress
NCBI taxonomy ID ncbi_taxonomy_id	3702
Host organism host_organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

Entity 2 Entity 2 polymer

Description description	DNA (40-MER)
Molecular weight formula_weight	12346.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

TAGCTGAGTGATCCGGAGTCTGAAACAATGCATCACATGC

Source Source

Source organism organism	Arabidopsis thaliana
Common name common_name	thale cress
NCBI taxonomy ID ncbi_taxonomy_id	3702
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA (40-MER)
Molecular weight formula_weight	12171.8 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GCATGTGATGCATTGTTTCAGACTCXGGATCACTCAGCTA

Source Source

Source organism organism	Arabidopsis thaliana
Common name common_name	thale cress
NCBI taxonomy ID ncbi_taxonomy_id	3702
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	IRON/SULFUR CLUSTER
Molecular weight formula_weight	351.6 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.90 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	84039

CryoEM structure of Arabidopsis ROS1 in complex with a covalent-linked reaction intermediate at 3.9 Angstroms resolution

1. Protein Identity and Related Structures Protein Identity & Related Structures

Sex-determining region Y protein,DNA glycosylase/AP lyase ROS1

State in the Current Structure

Other States of the Same Protein in the Database

Sex-determining region Y protein,DNA glycosylase/AP lyase ROS1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7yhq__assembly_1__model_1

7yhq__assembly_1__model_1 | I(q)

7yhq__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

7. Citations (1)

CryoEM structure of Arabidopsis ROS1 in complex with a covalent-linked reaction intermediate at 3.9 Angstroms resolution

1. Protein Identity and Related Structures Protein Identity & Related Structures

Sex-determining region Y protein,DNA glycosylase/AP lyase ROS1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Sex-determining region Y protein,DNA glycosylase/AP lyase ROS1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7yhq__assembly_1__model_1

7yhq__assembly_1__model_1 | I(q)

7yhq__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

7. Citations (1)