SAXSdb — 8pot

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucine--tRNA ligase

Escherichia coli K-12

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA(leu) × 1 1,2-ETHANEDIOL × 2 ;[(1R,3'S,5S,6R,8R)-3'-(aminomethyl)-8-(6-aminopurin-9-yl)-4'-bromanyl-7'-[3-[methyl-(phenylmethyl)amino]propoxy]spiro[2,4,7-trioxa-3$l^{4}-borabicyclo[3.3.0]octane-3,1'-3H-2,1$l^{4}-benzoxaborole]-6-yl]methyl dihydrogen phosphate ; × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYL_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 21–880； UniProt 1–860

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8pot
Deposition date deposition_date	2023-07-05
Structure title title	Ternary complex of E. coli leucyl-tRNA synthetase, tRNA(leu) and the benzoxaborole cmpd9 in the editing conformation
Keywords keywords	;Leucine tRNA ligase, ATP binding protein, tRNA aminoacylation for protein translation, cytosolic Reaction catalysed: ATP + L-leucine + tRNA(Leu) = AMP + diphosphate + L-leucyl-tRNA(Leu), LIGASE ;; LIGASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8pot__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8pot__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8pot__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	34.28 Å
Rg (electron density)	34.15 Å
Total Rg	34.55 Å
Atom count	8346
Residues	900
Excluded volume	141830 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8pot__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Leucine--tRNA ligase
Molecular weight formula_weight	99516.0 kDa
EC 编号 ec_number	6.1.1.4
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	8743

MGSSHHHHHHSSGLVPRGSHMQEQYRPEEIESKVQLHWDEKRTFEVTEDESKEKYYCLSMLPYPSGRLHMGHVRNYTIGDVIARYQRMLGKNVLQPIGWDAFGLPAEGAAVKNNTAPAPWTYDNIAYMKNQLKMLGFGYDWSRELATCTPEYYRWEQKFFTELYKKGLVYKKTSAVNWCPNDQTVLANEQVIDGCCWRCDTKVERKEIPQWFIKITAYADELLNDLDKLDHWPDTVKTMQRNWIGRSEGVEITFNVNDYDNTLTVYTTRPDTFMGCTYLAVAAGHPLAQKAAENNPELAAFIDECRNTKVAEAEMATMEKKGVDTGFKAVHPLTGEEIPVWAANFVLMEYGTGAVMAVPGHDQRDYEFASKYGLNIKPVILAADGSEPDLSQQALTEKGVLFNSGEFNGLDHEAAFNAIADKLTAMGVGERKVNYRLRDWGVSRQRYWGAPIPMVTLEDGTVMPTPDDQLPVILPEDVVMDGITSPIKADPEWAKTTVNGMPALRETDTFDTFMESSWYYARYTCPQYKEGMLDSEAANYWLPVDIYIGGIEHAIMHLLYFRFFHKLMRDAGMVNSDEPAKQLLCQGMVLADAFYYVGENGERNWVSPVDAIVERDEKGRIVKAKDAAGHELVYTGMSKMSKSKNNGIDPQVMVERYGADTVRLFMMFASPADMTLEWQESGVEGANRFLKRVWKLVYEHTAKGDVAALNVDALTENQKALRRDVHKTIAKVTDDIGRRQTFNTAIAAIMELMNKLAKAPTDGEQDRALMQEALLAVVRMLNPFTPHICFTLWQELKGEGDIDNAPWPVADEKAMVEDSTLVVVQVNGKVRAKITVPVDATEEQVRERAGQEHLVAKYLDGVTVRKVIYVPGKLLNLVVG

Source Source

Source organism organism	Escherichia coli K-12
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	tRNA(leu)
Molecular weight formula_weight	28052.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GCCCGGAUGGUGGAAUCGGUAGACACAAGGGAUUUAAAAUCCCUCGGCGUUCGCGCUGUGCGGGUUCAAGUCCCGCUCCGGGUACCA

Entity 3 Entity 3 non-polymer

Description description	1,2-ETHANEDIOL
Molecular weight formula_weight	62.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	;[(1R,3'S,5S,6R,8R)-3'-(aminomethyl)-8-(6-aminopurin-9-yl)-4'-bromanyl-7'-[3-[methyl-(phenylmethyl)amino]propoxy]spiro[2,4,7-trioxa-3$l^{4}-borabicyclo[3.3.0]octane-3,1'-3H-2,1$l^{4}-benzoxaborole]-6-yl]methyl dihydrogen phosphate ;
Molecular weight formula_weight	747.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	377

▶

Unit-cell length a length_a	89.167 Å
Unit-cell length b length_b	76.794 Å
Unit-cell length c length_c	90.863 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	102.55 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.149 Å
Low-resolution limit resolution_low	58.060 Å
R factor r_factor	0.2166
R_work r_work	0.2139
R_free r_free	0.2652

Ternary complex of E. coli leucyl-tRNA synthetase, tRNA(leu) and the benzoxaborole cmpd9 in the editing conformation

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8pot__assembly_1__model_1

8pot__assembly_1__model_1 | I(q)

8pot__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Citations (1)

Ternary complex of E. coli leucyl-tRNA synthetase, tRNA(leu) and the benzoxaborole cmpd9 in the editing conformation

1. Protein Identity and Related Structures Protein Identity & Related Structures

Leucine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8pot__assembly_1__model_1

8pot__assembly_1__model_1 | I(q)

8pot__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Citations (1)