SAXSdb — 8rao

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Helicase SEN1

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain O； UniProt 1–2231	Not recorded	RNA × 1 ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1 BEF BERYLLIUM TRIFLUORIDE ION × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 4.40 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 8RAO	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
5MZN Helicase Sen1 Deposited 2017-02-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1095–1470（376 aa） Chain A 1539–1904（366 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 40 GOL GLYCEROL × 12 PEG DI(HYDROXYETHYL)ETHER × 11 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.2；277 K；18% PEG 2K 0.1M MOPS 7.2	Resolution 1.79 Å R-free 0.184
6GC3 Structure of Nrd1 CID - Sen1 NIM complex Deposited 2018-04-17	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 2052–2063（12 aa）	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 8；293 K；Ionic strength (raw mmCIF value) 100；Pressure 1 NMR sample composition 1.0 mM [U-99% 13C; U-99% 15N] CTD-interacting domain of Nrd1, 1.5 mM ASP-ASP-ASP-GLU-ASP-ASP-TYR-THR-PRO-SER-ILE-SER, 90% H2O/10% D2O \| 90% H2O/10% D2O	Resolution not provided
6I59 Long wavelength native-SAD phasing of Sen1 helicase Deposited 2018-11-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1095–1470（376 aa） Chain A 1539–1904（366 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 40 GOL GLYCEROL × 12 PEG DI(HYDROXYETHYL)ETHER × 11 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.2；277 K；18% PEG 2K 0.1M MOPS 7.2	Resolution 2.95 Å R-free 0.213
6O3W Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM1 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain C 1882–1895（14 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 2.10 Å R-free 0.204
6O3W Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM1 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain D 1882–1895（14 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 2.10 Å R-free 0.204
6O3X Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM2 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain D 2053–2064（12 aa）	Not recorded	CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 1.99 Å R-free 0.226
6O3X Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM2 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain E 2053–2064（12 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 1.99 Å R-free 0.226
6O3X Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM2 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain F 2053–2064（12 aa）	Not recorded	CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 1.99 Å R-free 0.226
6O3Y Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM3 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain D 2181–2193（13 aa）	Not recorded	CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 2.80 Å R-free 0.300
6O3Y Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM3 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain E 2181–2193（13 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 2.80 Å R-free 0.300
6O3Y Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM3 Deposited 2019-02-27	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain F 2181–2193（13 aa）	Not recorded	CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4；293 K；sodium citrate, lithium chloride, PEG 6000	Resolution 2.80 Å R-free 0.300
8RAM Structure of Sen1 bound RNA Polymerase II pre-termination complex Deposited 2023-12-01	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 16 PDB declaration: 19-meric	Chain O 1–2231（2231 aa）	Not recorded	ZN ZINC ION × 9 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
8RAN Structure of Sen1-RNA complex Deposited 2023-12-01	Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain O 1–2231（2231 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.25 Å
8RAP Structure of Sen1-ADP.BeF3 bound RNA Polymerase II pre-termination complex Deposited 2023-12-01	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 16 PDB declaration: 19-meric	Chain O 1–2231（2231 aa）	Not recorded	ZN ZINC ION × 9 MG MAGNESIUM ION × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 1 BEF BERYLLIUM TRIFLUORIDE ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.30 Å

9 other PDB entries and 14 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	SEN1_YEAST
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain O； PDBConstruct 1–2231； UniProt 1–2231

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8rao
Deposition date deposition_date	2023-12-01
Structure title title	Structure of Sen1-ADP.BeF3-RNA complex
Keywords keywords	RNA Polymerase II, Pol II, termination, Sen1, GENE REGULATION; GENE REGULATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	28.06 Å
Radius of gyration Rg (electron density) rg_electron	27.26 Å
Forward intensity I(0) i0	116731000.00
Molecular weight molecular_weight	82545.0 kDa
Excluded volume excluded_volume	102260 Å³
Envelope volume envelope_volume	126310 Å³
Hydration-shell volume shell_volume	37441 Å³
Envelope diameter envelope_diameter	98.2 Å
Shell Rg shell_rg	35.49 Å
Envelope Rg envelope_rg	27.70 Å
Shape Rg shape_rg	27.29 Å
Total Rg total_rg	27.94 Å
Total atoms total_atoms	5781
Residues n_residues	703
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	89.4 Å
Rg (real space) rg_real	27.95 Å
Rg uncertainty (real space) rg_real_error	0.59 Å
I(0) (real space) i0_real	1.1670e+08
I(0) uncertainty (real space) i0_real_error	1.6770e+06
Rg (reciprocal space) rg_reciprocal	27.99 Å
I(0) (reciprocal space) i0_reciprocal	116700000.0000
Solution quality estimate total_estimate	0.8203
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	33.0 Å
Skewness Skewness skewness	0.261
Kurtosis Kurtosis kurtosis	-0.388
Angular range angular_range	— – 0.2850 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	21700000.0000
Real-space data points n_real_points	58
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.889; Stabil: 0.998; Sysdev: 1.000; Positv: 1.000; Valcen: 0.997; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Helicase SEN1
Molecular weight formula_weight	252835.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	O
Atom count atom_count	5781

MNSNNPDNNNSNNINNNNKDKDIAPNSDVQLATVYTKAKSYIPQIEQVYQGTNPNIQEAKLLGELLQVLAEVPKGTHLFCDPILEPISIFSLTIFSFNEEATATWLKNHFNPILSVCDKCILNFARGKCKMLQHFAIQRHVPHEHVAKFNDIVCQWRVEAVFPILRNISVNDNTGINITNEIETAMYECLCNPHMLRLNKQLKATFEAIFKFFYDTKHRLLDVTNPLSIKTFISGVIFCWCEGSKEENEWSRAFLKDLYSRNFHINLSNLTPDIIEEVYIHILFLQNPANWTEIVVSQFWSRLLPVFNLFDKDVFIEYFQVPKNVESLKKTFKFPLEPIFKMWYNHLSKSYHDKPLDFLLRGLTMFLNKFGSEFWSKIEPFTFHSILDIIFNRDSFPIKLIKIQDNPIVEHQTEVYFQLTGSVTDLLSWTLPFYHALSPSKRIQMVRKVSMAFLRIIANYPSLKSIPKACLMNSATALLRAVLTIKENERAMLYKNDEFETVLLTKTDSRALLNNPLIQDIIIRSASNPNDFYPGLGAASASVATSTMMVLAECIDFDILLLCHRTFKLYSGKPISEIPISTNVLENVTNKIDLRSFHDGPLLAKQLLVSLKNINGLLIVPSNTAVAEAHNALNQKFLLLSTRLMEKFADILPGQLSKILADEDASQGFWSCIFSSDKHLYQAATNILYNTFDVEGRLEGILAILNSNLTVNLKNINVMLQRLINCEFYEPCPRAVRVLMDVVSAFVDPISGVFANFQTLKSQNTEKEFLKFWESCWLFLDTIYKFTLKWASKYDYSELENFTKDTLDLSRSLVDSFREFSDILHDQTKNLLLNVLETFKNMLYWLRLSDEVLLESCVRLIISTSDLAHEKHVKVDDSLVEMMAKYASKAKRFSNKLTEQQASEILQKAKIFNKALTEEVATEAENYRKEKELSRLGKVIDLTDSVPASPSLSPSLSSTIASSSAESRADYLQRKALSSSITGRPRVAQPKITSFGTFQSSANAKLHRTKPVKPLSKMELARMQLLNNRVVHPPSAPAFHTKSRGLSNKNDDSSSEESDNDIESARELFAIAKAKGKGIQTVDINGKVVKRQTAAELAKQELEHMRKRLNVDMNPLYEIILQWDYTRNSEYPDDEPIGNYSDVKDFFNSPADYQKVMKPLLLLESWQGLCSSRDREDYKPFSIIVGNRTAVSDFYDVYASVAKQVIQDCGISESDLIVMAYLPDFRPDKRLSSDDFKKAQHTCLAKVRTLKNTKGGNVDVTLRIHRNHSFSKFLTLRSEIYCVKVMQMTTIEREYSTLEGLEYYDLVGQILQAKPSPPVNVDAAEIETVKKSYKLNTSQAEAIVNSVSKEGFSLIQGPPGTGKTKTILGIIGYFLSTKNASSSNVIKVPLEKNSSNTEQLLKKQKILICAPSNAAVDEICLRLKSGVYDKQGHQFKPQLVRVGRSDVVNVAIKDLTLEELVDKRIGERNYEIRTDPELERKFNNAVTKRRELRGKLDSESGNPESPMSTEDISKLQLKIRELSKIINELGRDRDEMREKNSVNYRNRDLDRRNAQAHILAVSDIICSTLSGSAHDVLATMGIKFDTVIIDEACQCTELSSIIPLRYGGKRCIMVGDPNQLPPTVLSGAASNFKYNQSLFVRMEKNSSPYLLDVQYRMHPSISKFPSSEFYQGRLKDGPGMDILNKRPWHQLEPLAPYKFFDIISGRQEQNAKTMSYTNMEEIRVAIELVDYLFRKFDNKIDFTGKIGIISPYREQMQKMRKEFARYFGGMINKSIDFNTIDGFQGQEKEIILISCVRADDTKSSVGFLKDFRRMNVALTRAKTSIWVLGHQRSLAKSKLWRDLIEDAKDRSCLAYACSGFLDPRNNRAQSILRKFNVPVPSEQEDDYKLPMEYITQGPDEVKSNKDTKKRRVVDEGEEADKAVKKKKKEKKKEKKKSKADDKKKNNKKAESPSTSSGTKKKSSIFGGMSVPSAVVPKTFPDVDSNKKAAAVVGKKKNNKHVCFSDDVSFIPRNDEPEIKVTRSLSSVLKEKQLGLKETRTISPPEISNNEDDDDEDDYTPSISDSSLMKSEANGRNNRVASHNQNFSASIYDDPQVSQAKQTQVPAAITKHRSSNSVLSGGSSRILTASDYGEPNQNGQNGANRTLSQHVGNANQYSTAPVGTGELHETLPAHPQDSYPAEAEDPYDLNPHPQPQSSAFKGPGSGPTGTRNSSRRNASSSPFIPKKRKPRS

来源 Source

来源生物 organism	Saccharomyces cerevisiae
通用名 common_name	;brewer's yeast ;
NCBI Class编号 ncbi_taxonomy_id	4932
宿主生物 host_organism	Trichoplusia ni

Entity 2 Entity 2 polymer

Description description	RNA
Molecular weight formula_weight	11282.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	P

AGUCGUGCGUCUAAUAACCGGAGAGGGAACCCACU

Entity 3 Entity 3 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	BERYLLIUM TRIFLUORIDE ION
Molecular weight formula_weight	66.0 kDa
Source method src_method	syn
Copy count entity_count	1

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	4.40 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	15633

fit	/app/data/saxs_computation/ra/8rao/8rao.fit
pddf	/app/data/pr_computation/ra/8rao/8rao.pr.out
profile	/app/data/saxs_computation/ra/8rao/8rao.dat

Structure of Sen1-ADP.BeF3-RNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Helicase SEN1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)