SAXSdb — 8sh0

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protection of telomeres protein 1

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 1	;DNA (5'-D(PCPCPAPGPCPAPGPGPGPGPTPTPAPGPGPGPTPTPAPG)-3') ; × 1 ACETATE ION × 3 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	POTE1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–300； UniProt 1–299

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8sh0
Deposition date deposition_date	2023-04-13
Last revision last_revision	2023-08-30
Structure title title	Structure of human POT1 DNA binding domain bound to a 5'-phosphorylated junction of a telomeric DNA hairpin with a 3'-overhang
Keywords keywords	;shelterin, telomere, DNA junction, 5'-phosphorylated, POT-hole, chromosome end protection, POT1, DBD, POT1-DNA complex, DNA BINDING PROTEIN, DNA BINDING PROTEIN-DNA complex ;; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8sh0__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8sh0__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8sh0__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	23.12 Å
Rg (electron density)	21.92 Å
Total Rg	22.79 Å
Atom count	2771
Residues	314
Excluded volume	48220 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8sh0__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Protection of telomeres protein 1
Molecular weight formula_weight	33811.8 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	2891

SMSLVPATNYIYTPLNQLKGGTIVNVYGVVKFFKPPYLSKGTDYCSVVTIVDQTNVKLTCLLFSGNYEALPIIYKNGDIVRFHRLKIQVYKKETQGITSSGFASLTFEGTLGAPIIPRTSSKYFNFTTEDHKMVEALRVWASTHMSPSWTLLKLCDVQPMQYFDLTCQLLGKAEVDGASFLLKVWDGTRTPFPSWRVLIQDLVLEGDLSHIHRLQNLTIDILVYDNHVHVARSLKVGSFLRIYSLHTKLQSMNSENQTMLSLEFHLHGGTSYGRGIRVLPESNSDVDQLKKDLESANLTA

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Trichoplusia ni

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(PCPCPAPGPCPAPGPGPGPGPTPTPAPGPGPGPTPTPAPG)-3') ;
Molecular weight formula_weight	6255.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

CCAGCAGGGGTTAGGGTTAG

Entity 3 Entity 3 non-polymer

Description description	ACETATE ION
Molecular weight formula_weight	59.0 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	120

▼

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id	8sh0A01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	8sh0A02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

▶

Unit-cell length a length_a	67.230 Å
Unit-cell length b length_b	67.230 Å
Unit-cell length c length_c	143.373 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 32 2 1
Space-group number int_tables_number	154
Crystal system crystal_system	trigonal

Resolution resolution	2.160 Å
Low-resolution limit resolution_low	45.190 Å
R factor r_factor	0.1818
R_work r_work	0.1800
R_free r_free	0.2214

Structure of human POT1 DNA binding domain bound to a 5'-phosphorylated junction of a telomeric DNA hairpin with a 3'-overhang

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protection of telomeres protein 1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8sh0__assembly_1__model_1

8sh0__assembly_1__model_1 | I(q)

8sh0__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (1)

Structure of human POT1 DNA binding domain bound to a 5'-phosphorylated junction of a telomeric DNA hairpin with a 3'-overhang

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protection of telomeres protein 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8sh0__assembly_1__model_1

8sh0__assembly_1__model_1 | I(q)

8sh0__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (1)