9d6n

Loop-Deleted DNA Polymerase Theta in Complex with a dsDNA Overhang and an Allostertic Inhibitor

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase theta

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 2	DNA Template × 1 DNA Primer × 1 MAGNESIUM ION × 1 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 ;2-{3-[(2R)-3-(dimethylamino)-2-hydroxypropyl]-2-oxoimidazolidin-1-yl}-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)(methyl)carbamate ; × 1 water × 3	Consistent with all polymers
2	Protein–DNA	Monomer	Protein 1 DNA 2	DNA Template × 1 DNA Primer × 1 MAGNESIUM ION × 1 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 ;2-{3-[(2R)-3-(dimethylamino)-2-hydroxypropyl]-2-oxoimidazolidin-1-yl}-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)(methyl)carbamate ; × 1 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPOLQ_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–652； UniProt 1819–2590 Author chain B； PDBConstruct 1–652； UniProt 1819–2590

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9d6n
Deposition date deposition_date	2024-08-15
Structure title title	Loop-Deleted DNA Polymerase Theta in Complex with a dsDNA Overhang and an Allostertic Inhibitor
Keywords keywords	DNA Polymerase Theta, DNA Polymerase, Allosteric Inhibitor, Protein-DNA Complex, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9d6n__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9d6n__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9d6n__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	28.63 Å
Rg (electron density)	27.87 Å
Total Rg	28.59 Å
Atom count	5858
Residues	675
Excluded volume	101710 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9d6n__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`9d6n__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	DNA polymerase theta
Molecular weight formula_weight	72589.8 kDa
EC 编号 ec_number	3.6.4.12,2.7.7.7,2.7.7.49
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	12006

SSSSESLSIIDVASDQNLFQTFIKEWRCKKRFSISLACEKIRGSGDDTLVVGLAVCWGGRDAYYFSLGGSGGLDPSLTLKDRMWYLQSCLRKESDKECSVVIYDFIQSYKILLLSCGISLEQSYEDPKVACWLLDPDSQEPTLHSIVTSFLPHELPLLEGMETSQGIQSLGLNAGSEHSGRYRASVESILIFNSMNQLNSLLQKENLQDVFRKVEMPSQYCLALLELNGIGFSTAECESQKHIMQAKLDAIETQAYQLAGHSFSFTSSDDIAEVLFLELKLPPGGSGGQFSTSKDVLNKLKALHPLPGLILEWRRITNAITKVVFPLQREKCLNPFLGMERIYPVSQSHTATGRITFTEPNIQNVPRDFEIKMGGSGGMPFSISMRHAFVPFPGGSILAADYSQLELRILAHLSHDRRLIQVLNTGADVFRSIAAEWKMIEPESVGDDLRQQAKQICYGIIYGMGAKSLGEQMGIKENDAACYIDSFKSRYTGINQFMTETVKNCKRDGFVQTILGRRRYLPGIKDNNPYRKAHAERQAINTIVQGSAADIVKIATVNIQKQLETFHSTFKSHGHREGMLQSDGGSGGCPIRGGFFILQLHDELLYEVAEEDVVQVAQIVKNEMESAVKLSVKLKVKVKIGASWGELKDFDV

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA Template
Molecular weight formula_weight	7372.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,C

GCGAGACTCCGCGCTGCGACGTCG

Entity 3 Entity 3 polymer

Description description	DNA Primer
Molecular weight formula_weight	4266.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F,D

CGACGTCGCAGCGC

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	491.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	;2-{3-[(2R)-3-(dimethylamino)-2-hydroxypropyl]-2-oxoimidazolidin-1-yl}-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)(methyl)carbamate ;
Molecular weight formula_weight	566.5 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 7 Entity 7 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	308

▶

Unit-cell length a length_a	171.119 Å
Unit-cell length b length_b	171.119 Å
Unit-cell length c length_c	118.026 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 32 2 1
Space-group number int_tables_number	154
Crystal system crystal_system	trigonal

Resolution resolution	2.430 Å
Low-resolution limit resolution_low	92.320 Å
R factor r_factor	0.2114
R_work r_work	0.2100
R_free r_free	0.2374

Loop-Deleted DNA Polymerase Theta in Complex with a dsDNA Overhang and an Allostertic Inhibitor

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase theta

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9d6n__assembly_2__model_1

9d6n__assembly_2__model_1 | I(q)

9d6n__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

7. Citations (1)

Loop-Deleted DNA Polymerase Theta in Complex with a dsDNA Overhang and an Allostertic Inhibitor

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase theta

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9d6n__assembly_2__model_1

9d6n__assembly_2__model_1 | I(q)

9d6n__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

7. Citations (1)