SAXSdb — 9hju

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

E3 ubiquitin-protein ligase ZFP91

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 9 DNA 2	Selenide, water dikinase 1 × 4 （P49903） Transcriptional regulator QRICH1 × 4 （Q2TAL8） DNA (31-MER) × 1 DNA (31-MER) × 1 ZINC ION × 5	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ZFP91_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–570； UniProt 1–570

Selenide, water dikinase 1

Homo sapiens

UniProt P49903

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 9 DNA 2	E3 ubiquitin-protein ligase ZFP91 × 1 （Q96JP5） Transcriptional regulator QRICH1 × 4 （Q2TAL8） DNA (31-MER) × 1 DNA (31-MER) × 1 ZINC ION × 5	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SPS1_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–392； UniProt 1–392 Author chain C； PDBConstruct 1–392； UniProt 1–392 Author chain F； PDBConstruct 1–392； UniProt 1–392 Author chain G； PDBConstruct 1–392； UniProt 1–392

Transcriptional regulator QRICH1

Homo sapiens

UniProt Q2TAL8

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 9 DNA 2	E3 ubiquitin-protein ligase ZFP91 × 1 （Q96JP5） Selenide, water dikinase 1 × 4 （P49903） DNA (31-MER) × 1 DNA (31-MER) × 1 ZINC ION × 5	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	QRIC1_HUMAN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain D； PDBConstruct 1–776； UniProt 1–776 Author chain E； PDBConstruct 1–776； UniProt 1–776 Author chain H； PDBConstruct 1–776； UniProt 1–776 Author chain I； PDBConstruct 1–776； UniProt 1–776

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9hju
Deposition date deposition_date	2024-12-02
Structure title title	Structure of 2x Zincore (SEPHS1:QRICH1) binding to ZFP91 on DNA
Keywords keywords	;Zincore Complex, Transcriptional regulator complex, SEPHS1, Selenide, water dikinase 1, selenophosphate synthetase 1, QRICH1, Zinc finger protein, ZFP91, Transcription factor, STRUCTURAL PROTEIN ;; STRUCTURAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9hju__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9hju__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9hju__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	55.41 Å
Rg (electron density)	55.78 Å
Total Rg	55.80 Å
Atom count	47665
Residues	2944
Excluded volume	426850 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9hju__assembly_1__model_1`	11-meric （11）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	E3 ubiquitin-protein ligase ZFP91
Molecular weight formula_weight	63557.2 kDa
EC 编号 ec_number	2.3.2.27
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	47665

MPGETEEPRPPEQQDQEGGEAAKAAPEEPQQRPPEAVAAAPAGTTSSRVLRGGRDRGRAAAAAAAAAVSRRRKAEYPRRRRSSPSARPPDVPGQQPQAAKSPSPVQGKKSPRLLCIEKVTTDKDPKEEKEEEDDSALPQEVSIAASRPSRGWRSSRTSVSRHRDTENTRSSRSKTGSLQLICKSEPNTDQLDYDVGEEHQSPGGISSEEEEEEEEEMLISEEEIPFKDDPRDETYKPHLERETPKPRRKSGKVKEEKEKKEIKVEVEVEVKEEENEIREDEEPPRKRGRRRKDDKSPRLPKRRKKPPIQYVRCEMEGCGTVLAHPRYLQHHIKYQHLLKKKYVCPHPSCGRLFRLQKQLLRHAKHHTDQRDYICEYCARAFKSSHNLAVHRMIHTGEKPLQCEICGFTCRQKASLNWHMKKHDADSFYQFSCNICGKKFEKKDSVVAHKAKSHPEVLIAEALAANAGALITSTDILGTNPESLTQPSDGQGLPLLPEPLGNSTSGECLLLEAEGMSKSYCSGTERVSLMADGKIFVGSGSSGGTEGLVMNSDILGATTEVLIEDSDSAGP

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 2 Entity 2 polymer

Description description	Selenide, water dikinase 1
Molecular weight formula_weight	42953.5 kDa
EC 编号 ec_number	2.7.9.3
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,C,F,G

MSTRESFNPESYELDKSFRLTRFTELKGTGCKVPQDVLQKLLESLQENHFQEDEQFLGAVMPRLGIGMDTCVIPLRHGGLSLVQTTDYIYPIVDDPYMMGRIACANVLSDLYAMGVTECDNMLMLLGVSNKMTDRERDKVMPLIIQGFKDAAEEAGTSVTGGQTVLNPWIVLGGVATTVCQPNEFIMPDNAVPGDVLVLTKPLGTQVAVAVHQWLDIPEKWNKIKLVVTQEDVELAYQEAMMNMARLNRTAAGLMHTFNAHAATDITGFGILGHAQNLAKQQRNEVSFVIHNLPVLAKMAAVSKACGNMFGLMHGTCPETSGGLLICLPREQAARFCAEIKSPKYGEGHQAWIIGIVEKGNRTARIIDKPRIIEVAPQVATQNVNPTPGATS

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Insect cell expression vector pTIE1

Entity 3 Entity 3 polymer

Description description	Transcriptional regulator QRICH1
Molecular weight formula_weight	86507.2 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D,E,H,I

MNNSLENTISFEEYIRVKARSVPQHRMKEFLDSLASKGPEALQEFQQTATTTMVYQQGGNCIYTDSTEVAGSLLELACPVTTSVQPQTQQEQQIQVQQPQQVQVQVQVQQSPQQVSAQLSPQLTVHQPTEQPIQVQVQIQGQAPQSAAPSIQTPSLQSPSPSQLQAAQIQVQHVQAAQQIQAAEIPEEHIPHQQIQAQLVAGQSLAGGQQIQIQTVGALSPPPSQQGSPREGERRVGTASVLQPVKKRKVDMPITVSYAISGQPVATVLAIPQGQQQSYVSLRPDLLTVDSAHLYSATGTITSPTGETWTIPVYSAQPRGDPQQQSITHIAIPQEAYNAVHVSGSPTALAAVKLEDDKEKMVGTTSVVKNSHEEVVQTLANSLFPAQFMNGNIHIPVAVQAVAGTYQNTAQTVHIWDPQQQPQQQTPQEQTPPPQQQQQQLQVTCSAQTVQVAEVEPQSQPQPSPELLLPNSLKPEEGLEVWKNWAQTKNAELEKDAQNRLAPIGRRQLLRFQEDLISSAVAELNYGLCLMTREARNGEGEPYDPDVLYYIFLCIQKYLFENGRVDDIFSDLYYVRFTEWLHEVLKDVQPRVTPLGYVLPSHVTEEMLWECKQLGAHSPSTLLTTLMFFNTKYFLLKTVDQHMKLAFSKVLRQTKKNPSNPKDKSTSIRYLKALGIHQTGQKVTDDMYAEQTENPENPLRCPIKLYDFYLFKCPQSVKGRNDTFYLTPEPVVAPNSPIWYSVQPISREQMGQMLTRILVIREIQEAIAVANASTMH

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 4 Entity 4 polymer

Description description	DNA (31-MER)
Molecular weight formula_weight	9315.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	K

GCGACCTGCCCCTTTAAGAGCACCCCCCTCC

Entity 5 Entity 5 polymer

Description description	DNA (31-MER)
Molecular weight formula_weight	9755.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	L

GGAGGGGGGTGCTCTTAAAGGGGCAGGTCGC

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	5

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.160 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	3.16 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	138830

Structure of 2x Zincore (SEPHS1:QRICH1) binding to ZFP91 on DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

E3 ubiquitin-protein ligase ZFP91

State in the Current Structure

Other States of the Same Protein in the Database

Selenide, water dikinase 1

State in the Current Structure

Other States of the Same Protein in the Database

Transcriptional regulator QRICH1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9hju__assembly_1__model_1

9hju__assembly_1__model_1 | I(q)

9hju__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)

Structure of 2x Zincore (SEPHS1:QRICH1) binding to ZFP91 on DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

E3 ubiquitin-protein ligase ZFP91

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Selenide, water dikinase 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Transcriptional regulator QRICH1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9hju__assembly_1__model_1

9hju__assembly_1__model_1 | I(q)

9hju__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)