SAXSdb — 9nuh

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Minichromosome maintenance protein MCM,DNA helicase

Pyrococcus furiosus DSM 3638

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 6 DNA 2	DNA (60-MER) × 2 ADENOSINE-5'-DIPHOSPHATE × 6 MAGNESIUM ION × 6 ZINC ION × 6 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	A0A5C0XP52_PYRFU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 271–375； UniProt 257–361 Author chain A； PDBConstruct 376–613； UniProt 729–966 Author chain B； PDBConstruct 271–375； UniProt 257–361 Author chain B； PDBConstruct 376–613； UniProt 729–966 Author chain C； PDBConstruct 271–375； UniProt 257–361 Author chain C； PDBConstruct 376–613； UniProt 729–966 Author chain D； PDBConstruct 271–375； UniProt 257–361 Author chain D； PDBConstruct 376–613； UniProt 729–966 Author chain E； PDBConstruct 271–375； UniProt 257–361 Author chain E； PDBConstruct 376–613； UniProt 729–966 Author chain F； PDBConstruct 271–375； UniProt 257–361 Author chain F； PDBConstruct 376–613； UniProt 729–966

Minichromosome maintenance protein MCM,DNA helicase

Pyrococcus furiosus DSM 3638

UniProt Q9UXG1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 6 DNA 2	DNA (60-MER) × 2 ADENOSINE-5'-DIPHOSPHATE × 6 MAGNESIUM ION × 6 ZINC ION × 6 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MCM_SACS2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 3–270； UniProt 2–269 Author chain B； PDBConstruct 3–270； UniProt 2–269 Author chain C； PDBConstruct 3–270； UniProt 2–269 Author chain D； PDBConstruct 3–270； UniProt 2–269 Author chain E； PDBConstruct 3–270； UniProt 2–269 Author chain F； PDBConstruct 3–270； UniProt 2–269

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9nuh
Deposition date deposition_date	2025-03-19
Structure title title	SsoPfMCM:DNA class 1a from merged particles
Keywords keywords	DNA replication, helicase, MCM, REPLICATION, HYDROLASE- DNA complex, HYDROLASE-DNA complex; REPLICATION, HYDROLASE/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9nuh__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9nuh__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9nuh__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	49.21 Å
Rg (electron density)	48.78 Å
Total Rg	49.01 Å
Atom count	59192
Residues	3592
Excluded volume	525410 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9nuh__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Minichromosome maintenance protein MCM,DNA helicase
Molecular weight formula_weight	69472.3 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F
Atom count atom_count	59216

SLEIPSKQIDYRDVFIEFLTTFKGNNNQNKYIERINELVAYRKKSLIIEFSDVLSFNENLAYEIINNTKIILPILEGALYDHILQLDPTYQRDIEKVHVRIVGIPRVIELRKIRSTDIGKLITIDGILVKVTPVKERIYKATYKHIHPDCMQEFEWPEDEEMPEVLEMPTICPKCGKPGQFRLIPEKTKLIDWQKAVIQERPEEVPSGQLPRQLEIILEDDLVDSARPGDRVKVTGILDIKQDSPVKRGSRAVFDIYMKVSSIEVSQKVLQELEISPEEEQIIKELAKRKDIVDAIVDSIAPAIYGYKEVKKGIALALFGGVSRKLPDGTRLRGDIHVLLVGDPGVAKSQILRYVANLAPRAIYTSGKSSSAAGLTAAAVRDEFTGGWVLEAGALVLADGGYALIDELDKMSDRDRSVIHEALEQQTISISKAGITATLNARTTVIAAANPKQGRFNRMKNPFEQIDLPPTLLSRFDLIFVLIDEPDDKIDSEVARHILRVRRGESEVVAPKIPHEILRKYIAYARKNIHPVISEEAMEEIEKYYVRMRKSVKKTKGEEEGIPPIPITARQLEALIRLSEAHARMRLSPIVTREDAREAIKLMEYTLKQIAMD

Source Source

Source organism organism	Pyrococcus furiosus DSM 3638
NCBI taxonomy ID ncbi_taxonomy_id	186497
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA (60-MER)
Molecular weight formula_weight	18491.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X,Y

ACTGACTGACTGACTGACTGACTGACTGACGTCAGTCAGTCAGTCAGTCAGTCAGTCAGT

Entity 3 Entity 3 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	24

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	2.92 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	101708

SsoPfMCM:DNA class 1a from merged particles

1. Protein Identity and Related Structures Protein Identity & Related Structures

Minichromosome maintenance protein MCM,DNA helicase

State in the Current Structure

Other States of the Same Protein in the Database

Minichromosome maintenance protein MCM,DNA helicase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9nuh__assembly_1__model_1

9nuh__assembly_1__model_1 | I(q)

9nuh__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Citations (1)

SsoPfMCM:DNA class 1a from merged particles

1. Protein Identity and Related Structures Protein Identity & Related Structures

Minichromosome maintenance protein MCM,DNA helicase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Minichromosome maintenance protein MCM,DNA helicase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9nuh__assembly_1__model_1

9nuh__assembly_1__model_1 | I(q)

9nuh__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Citations (1)